lua benchmarks

34 files changed, 2123 insertions, 1 deletions

diff --git a/lua_benchmark/Makefile b/lua_benchmark/Makefile
new file mode 100644
index 0000000..7d73403
--- /dev/null
+++ b/lua_benchmark/Makefile
@@ -0,0 +1,27 @@
+.PHONY: all clean
+
+CFLAGS += -g
+CFLAGS += -O3
+CFLAGS += -llua5.4
+# CFLAGS += -fsanitize=address
+
+all: build/system build/magic_buddy build/jemalloc build/growing_magic_buddy
+
+build/system: main.c
+	@ mkdir -p build
+	$(CC) -DALLOC_SYSTEM $^ $(CFLAGS) -o $@
+
+build/jemalloc: main.c
+	@ mkdir -p build
+	$(CC) -DALLOC_SYSTEM -ljemalloc $^ $(CFLAGS) -o $@
+
+build/magic_buddy: main.c magic_buddy/magic_buddy.c
+	@ mkdir -p build
+	$(CC) -DALLOC_MAGIC_BUDDY $^ $(CFLAGS) -o $@
+
+build/growing_magic_buddy: main.c magic_buddy/magic_buddy.c
+	@ mkdir -p build
+	$(CC) -DALLOC_GROWING_MAGIC_BUDDY $^ $(CFLAGS) -o $@
+
+clean:
+	rm -rf build
diff --git a/lua_benchmark/benchmark.sh b/lua_benchmark/benchmark.sh
new file mode 100755
index 0000000..a7248ea
--- /dev/null
+++ b/lua_benchmark/benchmark.sh
@@ -0,0 +1,11 @@
+#!/bin/bash
+
+set -x
+set -e
+
+make -B
+
+time ./build/system $1
+time ./build/jemalloc $1
+time ./build/magic_buddy $1
+time ./build/growing_magic_buddy $1
diff --git a/lua_benchmark/magic_buddy b/lua_benchmark/magic_buddy
new file mode 120000
index 0000000..2d4a61e
--- /dev/null
+++ b/lua_benchmark/magic_buddy
@@ -0,0 +1 @@
+../magic_buddy
\ No newline at end of file
diff --git a/lua_benchmark/main.c b/lua_benchmark/main.c
new file mode 100644
index 0000000..a05c744
--- /dev/null
+++ b/lua_benchmark/main.c
@@ -0,0 +1,116 @@
+#include <stdlib.h>
+#include <stdio.h>
+#include <string.h>
+#include <fcntl.h>
+#include <assert.h>
+#include <unistd.h>
+#include <lua5.4/lua.h>
+#include <lua5.4/lauxlib.h>
+#include <lua5.4/lualib.h>
+
+static void get_random(uint8_t *dst, size_t count) {
+    int fd = open("/dev/urandom", O_RDONLY);
+    assert(count == read(fd, dst, count));
+    close(fd);
+}
+
+#if defined(ALLOC_MAGIC_BUDDY)
+
+#include "magic_buddy/magic_buddy.h"
+const size_t POOL_SIZE = 1024 * 1024 * 1024;
+static struct buddy BUDDY;
+
+static void init_allocator() {
+    uint8_t magic[MAGIC_COOKIE_BYTES];
+    get_random(magic, MAGIC_COOKIE_BYTES);
+
+    uint8_t *pool = malloc(POOL_SIZE);
+    init_buddy(pool, POOL_SIZE, magic, &BUDDY);
+}
+
+static void *allocator_fn(void *ud, void *ptr, size_t osize, size_t nsize) {
+    // https://www.lua.org/manual/5.4/manual.html#4.6
+    if (!ptr) return allocate(nsize, &BUDDY);
+
+    if (nsize == 0) {
+        liberate(ptr, osize, &BUDDY);
+        return NULL;
+    }
+
+    return reallocate(ptr, nsize, osize, &BUDDY);
+}
+
+#elif defined(ALLOC_GROWING_MAGIC_BUDDY)
+
+#include "magic_buddy/magic_buddy.h"
+static size_t POOL_SIZE;
+static void *POOL;
+static struct buddy BUDDY;
+
+static void init_allocator() {
+    uint8_t magic[MAGIC_COOKIE_BYTES];
+    get_random(magic, MAGIC_COOKIE_BYTES);
+
+    POOL_SIZE = 1024;
+    POOL = sbrk(POOL_SIZE);
+    assert(POOL != (void *)-1);
+    init_buddy(POOL, POOL_SIZE, magic, &BUDDY);
+}
+
+static int grow_pool() {
+    if (sbrk(POOL_SIZE) == (void *)-1) return 0;
+    POOL_SIZE *= 2;
+    grow_buddy(POOL, POOL_SIZE, &BUDDY);
+    return 1;
+}
+
+static void *allocator_fn(void *ud, void *ptr, size_t osize, size_t nsize) {
+    // https://www.lua.org/manual/5.4/manual.html#4.6
+    void *result = 0;
+    if (!ptr) {
+        while (!(result = allocate(nsize, &BUDDY)))
+            if (!grow_pool()) return 0;
+        return result;
+    }
+
+    if (nsize == 0) {
+        liberate(ptr, osize, &BUDDY);
+        return NULL;
+    }
+
+    while (!(result = reallocate(ptr, nsize, osize, &BUDDY)))
+        if (!grow_pool()) return 0;
+    return result;
+}
+
+#elif defined(ALLOC_SYSTEM)
+
+static void init_allocator() { }
+
+static void *allocator_fn(void *ud, void *ptr, size_t osize, size_t nsize) {
+    // https://www.lua.org/manual/5.4/manual.html#4.6
+    if (nsize == 0) {
+        free(ptr);
+        return NULL;
+    }
+    return realloc(ptr, nsize);
+}
+
+#else
+#error "No allocator chosen!"
+#endif
+
+int main(int argc, char **argv) {
+    init_allocator();
+
+    // https://www.lua.org/pil/24.1.html
+    char buff[256];
+    int error;
+    lua_State *L = lua_newstate(allocator_fn, 0);   /* opens Lua */
+    luaL_openlibs(L);
+
+    assert(argc == 2);
+    luaL_dofile(L, argv[1]);
+    lua_close(L);
+    return 0;
+}
diff --git a/lua_benchmark/tests/Lua-Benchmarks/.gitignore b/lua_benchmark/tests/Lua-Benchmarks/.gitignore
new file mode 100644
index 0000000..4558236
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/.gitignore
@@ -0,0 +1 @@
+results.*
diff --git a/lua_benchmark/tests/Lua-Benchmarks/LICENSE b/lua_benchmark/tests/Lua-Benchmarks/LICENSE
new file mode 100644
index 0000000..71c4e2e
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/LICENSE
@@ -0,0 +1,21 @@
+MIT License
+
+Copyright (c) 2017 Gabriel de Quadros Ligneul
+
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+
+The above copyright notice and this permission notice shall be included in all
+copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+SOFTWARE.
diff --git a/lua_benchmark/tests/Lua-Benchmarks/ack.lua b/lua_benchmark/tests/Lua-Benchmarks/ack.lua
new file mode 100644
index 0000000..3b41935
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/ack.lua
@@ -0,0 +1,16 @@
+-- $Id: ackermann.lua,v 1.5 2000/12/09 20:07:43 doug Exp $

+-- http://www.bagley.org/~doug/shootout/

+

+local function Ack(M, N)

+    if (M == 0) then

+        return N + 1

+    end

+    if (N == 0) then

+        return Ack(M - 1, 1)

+    end

+    return Ack(M - 1, Ack(M, (N - 1)))

+end

+

+N = tonumber((arg and arg[1])) or 3

+M = tonumber((arg and arg[2])) or 8

+print(string.format("Ack(%d, %d) = %d\n", N, M, Ack(N,M)))

diff --git a/lua_benchmark/tests/Lua-Benchmarks/binary-trees.lua b/lua_benchmark/tests/Lua-Benchmarks/binary-trees.lua
new file mode 100644
index 0000000..d7f52e3
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/binary-trees.lua
@@ -0,0 +1,51 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+local function BottomUpTree(item, depth)
+  if depth > 0 then
+    local i = item + item
+    depth = depth - 1
+    local left, right = BottomUpTree(i-1, depth), BottomUpTree(i, depth)
+    return { item, left, right }
+  else
+    return { item }
+  end
+end
+
+local function ItemCheck(tree)
+  if tree[2] then
+    return tree[1] + ItemCheck(tree[2]) - ItemCheck(tree[3])
+  else
+    return tree[1]
+  end
+end
+
+-- local N = tonumber(arg and arg[1]) or 0
+local N = 15
+local mindepth = 4
+local maxdepth = mindepth + 2
+if maxdepth < N then maxdepth = N end
+
+do
+  local stretchdepth = maxdepth + 1
+  local stretchtree = BottomUpTree(0, stretchdepth)
+  io.write(string.format("stretch tree of depth %d\t check: %d\n",
+    stretchdepth, ItemCheck(stretchtree)))
+end
+
+local longlivedtree = BottomUpTree(0, maxdepth)
+
+for depth=mindepth,maxdepth,2 do
+  local iterations = 2 ^ (maxdepth - depth + mindepth)
+  local check = 0
+  for i=1,iterations do
+    check = check + ItemCheck(BottomUpTree(1, depth)) +
+            ItemCheck(BottomUpTree(-1, depth))
+  end
+  io.write(string.format("%d\t trees of depth %d\t check: %d\n",
+    iterations*2, depth, check))
+end
+
+io.write(string.format("long lived tree of depth %d\t check: %d\n",
+  maxdepth, ItemCheck(longlivedtree)))
diff --git a/lua_benchmark/tests/Lua-Benchmarks/fannkuch-redux.lua b/lua_benchmark/tests/Lua-Benchmarks/fannkuch-redux.lua
new file mode 100644
index 0000000..51f5fc6
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/fannkuch-redux.lua
@@ -0,0 +1,49 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+local function fannkuch(n)
+  local p, q, s, sign, maxflips, sum = {}, {}, {}, 1, 0, 0
+  for i=1,n do p[i] = i; q[i] = i; s[i] = i end
+  repeat
+    -- Copy and flip.
+    local q1 = p[1]				-- Cache 1st element.
+    if q1 ~= 1 then
+      for i=2,n do q[i] = p[i] end		-- Work on a copy.
+      local flips = 1
+      repeat
+	local qq = q[q1]
+	if qq == 1 then				-- ... until 1st element is 1.
+	  sum = sum + sign*flips
+	  if flips > maxflips then maxflips = flips end -- New maximum?
+	  break
+	end
+	q[q1] = q1
+	if q1 >= 4 then
+	  local i, j = 2, q1 - 1
+	  repeat q[i], q[j] = q[j], q[i]; i = i + 1; j = j - 1; until i >= j
+	end
+	q1 = qq; flips = flips + 1
+      until false
+    end
+    -- Permute.
+    if sign == 1 then
+      p[2], p[1] = p[1], p[2]; sign = -1	-- Rotate 1<-2.
+    else
+      p[2], p[3] = p[3], p[2]; sign = 1		-- Rotate 1<-2 and 1<-2<-3.
+      for i=3,n do
+	local sx = s[i]
+	if sx ~= 1 then s[i] = sx-1; break end
+	if i == n then return sum, maxflips end	-- Out of permutations.
+	s[i] = i
+	-- Rotate 1<-...<-i+1.
+	local t = p[1]; for j=1,i do p[j] = p[j+1] end; p[i+1] = t
+      end
+    end
+  until false
+end
+
+-- local n = tonumber(arg and arg[1]) or 7
+local n = 10
+local sum, flips = fannkuch(n)
+io.write(sum, "\nPfannkuchen(", n, ") = ", flips, "\n")
diff --git a/lua_benchmark/tests/Lua-Benchmarks/fasta.lua b/lua_benchmark/tests/Lua-Benchmarks/fasta.lua
new file mode 100644
index 0000000..3c3fe63
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/fasta.lua
@@ -0,0 +1,106 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+-- Compability with Lua 5.3
+if not loadstring then
+    loadstring = load
+end
+if not unpack then
+    unpack = table.unpack
+end
+
+local Last = 42
+local function random(max)
+  local y = (Last * 3877 + 29573) % 139968
+  Last = y
+  return (max * y) / 139968
+end
+
+local function make_repeat_fasta(id, desc, s, n)
+  local write, sub = io.write, string.sub
+  write(">", id, " ", desc, "\n")
+  local p, sn, s2 = 1, #s, s..s
+  for i=60,n,60 do
+    write(sub(s2, p, p + 59), "\n")
+    p = p + 60; if p > sn then p = p - sn end
+  end
+  local tail = n % 60
+  if tail > 0 then write(sub(s2, p, p + tail-1), "\n") end
+end
+
+local function make_random_fasta(id, desc, bs, n)
+  io.write(">", id, " ", desc, "\n")
+  loadstring([=[
+    local write, char, unpack, n, random = io.write, string.char, unpack, ...
+    local buf, p = {}, 1
+    for i=60,n,60 do
+      for j=p,p+59 do ]=]..bs..[=[ end
+      buf[p+60] = 10; p = p + 61
+      if p >= 2048 then write(char(unpack(buf, 1, p-1))); p = 1 end
+    end
+    local tail = n % 60
+    if tail > 0 then
+      for j=p,p+tail-1 do ]=]..bs..[=[ end
+      p = p + tail; buf[p] = 10; p = p + 1
+    end
+    write(char(unpack(buf, 1, p-1)))
+  ]=], desc)(n, random)
+end
+
+local function bisect(c, p, lo, hi)
+  local n = hi - lo
+  if n == 0 then return "buf[j] = "..c[hi].."\n" end
+  local mid = math.floor(n / 2)
+  return "if r < "..p[lo+mid].." then\n"..bisect(c, p, lo, lo+mid)..
+         "else\n"..bisect(c, p, lo+mid+1, hi).."end\n"
+end
+
+local function make_bisect(tab)
+  local c, p, sum = {}, {}, 0
+  for i,row in ipairs(tab) do
+    c[i] = string.byte(row[1])
+    sum = sum + row[2]
+    p[i] = sum
+  end
+  return "local r = random(1)\n"..bisect(c, p, 1, #tab)
+end
+
+local alu =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"..
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"..
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"..
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"..
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"..
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"..
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+local iub = make_bisect{
+  { "a", 0.27 },
+  { "c", 0.12 },
+  { "g", 0.12 },
+  { "t", 0.27 },
+  { "B", 0.02 },
+  { "D", 0.02 },
+  { "H", 0.02 },
+  { "K", 0.02 },
+  { "M", 0.02 },
+  { "N", 0.02 },
+  { "R", 0.02 },
+  { "S", 0.02 },
+  { "V", 0.02 },
+  { "W", 0.02 },
+  { "Y", 0.02 },
+}
+
+local homosapiens = make_bisect{
+  { "a", 0.3029549426680 },
+  { "c", 0.1979883004921 },
+  { "g", 0.1975473066391 },
+  { "t", 0.3015094502008 },
+}
+
+local N = tonumber(arg and arg[1]) or 1000
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, N*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, N*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, N*5)
diff --git a/lua_benchmark/tests/Lua-Benchmarks/fixpoint-fact.lua b/lua_benchmark/tests/Lua-Benchmarks/fixpoint-fact.lua
new file mode 100644
index 0000000..743a67c
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/fixpoint-fact.lua
@@ -0,0 +1,24 @@
+-- fixed-point operator

+local Z = function (le)

+      local a = function (f)

+        return le(function (x) return f(f)(x) end)

+      end

+      return a(a)

+    end

+

+

+-- non-recursive factorial

+

+local F = function (f)

+      return function (n)

+               if n == 0 then return 1

+               else return n*f(n-1) end

+             end

+    end

+

+local fat = Z(F)

+

+local s = 0

+for i = 1, arg[1] or 100 do s = s + fat(i) end

+print(s)

+

diff --git a/lua_benchmark/tests/Lua-Benchmarks/heapsort.lua b/lua_benchmark/tests/Lua-Benchmarks/heapsort.lua
new file mode 100644
index 0000000..0aaf7cb
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/heapsort.lua
@@ -0,0 +1,48 @@
+local random, floor = math.random, math.floor

+floor = math.ifloor or floor

+

+function heapsort(n, ra)

+    local j, i, rra

+    local l = floor(n/2) + 1

+    -- local l = (n//2) + 1

+    local ir = n;

+    while 1 do

+        if l > 1 then

+            l = l - 1

+            rra = ra[l]

+        else

+            rra = ra[ir]

+            ra[ir] = ra[1]

+            ir = ir - 1

+            if (ir == 1) then

+                ra[1] = rra

+                return

+            end

+        end

+        i = l

+        j = l * 2

+        while j <= ir do

+            if (j < ir) and (ra[j] < ra[j+1]) then

+                j = j + 1

+            end

+            if rra < ra[j] then

+                ra[i] = ra[j]

+                i = j

+                j = j + i

+            else

+                j = ir + 1

+            end

+        end

+        ra[i] = rra

+    end

+end

+

+local Num = tonumber((arg and arg[1])) or 4

+for i=1,Num do

+  local N = tonumber((arg and arg[2])) or 10000

+  local a = {}

+  for i=1,N do a[i] = random() end

+  heapsort(N, a)

+  for i=1,N-1 do assert(a[i] <= a[i+1]) end

+end

+

diff --git a/lua_benchmark/tests/Lua-Benchmarks/k-nucleotide.lua b/lua_benchmark/tests/Lua-Benchmarks/k-nucleotide.lua
new file mode 100644
index 0000000..5deb58d
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/k-nucleotide.lua
@@ -0,0 +1,66 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+local function kfrequency(seq, freq, k, frame)
+  local sub = string.sub
+  local k1 = k - 1
+  for i=frame,string.len(seq)-k1,k do
+    local c = sub(seq, i, i+k1)
+    freq[c] = freq[c] + 1
+  end
+end
+
+local function freqdefault()
+  return 0
+end
+
+local function count(seq, frag)
+  local k = string.len(frag)
+  local freq = setmetatable({}, { __index = freqdefault })
+  for frame=1,k do kfrequency(seq, freq, k, frame) end
+  io.write(freq[frag] or 0, "\t", frag, "\n")
+end
+
+local function frequency(seq, k)
+  local freq = setmetatable({}, { __index = freqdefault })
+  for frame=1,k do kfrequency(seq, freq, k, frame) end
+  local sfreq, sn = {}, 1
+  for c,v in pairs(freq) do sfreq[sn] = c; sn = sn + 1 end
+  table.sort(sfreq, function(a, b)
+    local fa, fb = freq[a], freq[b]
+    return fa == fb and a > b or fa > fb
+  end)
+  sum = string.len(seq)-k+1
+  for _,c in ipairs(sfreq) do
+    io.write(string.format("%s %0.3f\n", c, (freq[c]*100)/sum))
+  end
+  io.write("\n")
+end
+
+local function readseq()
+  local sub = string.sub
+  for line in io.lines() do
+    if sub(line, 1, 1) == ">" and sub(line, 2, 6) == "THREE" then break end
+  end
+  local lines, ln = {}, 0
+  for line in io.lines() do
+    local c = sub(line, 1, 1)
+    if c == ">" then
+      break
+    elseif c ~= ";" then
+      ln = ln + 1
+      lines[ln] = line
+    end
+  end
+  return string.upper(table.concat(lines, "", 1, ln))
+end
+
+local seq = readseq()
+frequency(seq, 1)
+frequency(seq, 2)
+count(seq, "GGT")
+count(seq, "GGTA")
+count(seq, "GGTATT")
+count(seq, "GGTATTTTAATT")
+count(seq, "GGTATTTTAATTTATAGT")
diff --git a/lua_benchmark/tests/Lua-Benchmarks/mandel.lua b/lua_benchmark/tests/Lua-Benchmarks/mandel.lua
new file mode 100644
index 0000000..bd080da
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/mandel.lua
@@ -0,0 +1,66 @@
+local Complex={type="package"}

+

+local function complex(x,y)

+ return setmetatable({ re=x, im=y }, Complex.metatable)

+end

+

+function Complex.conj(x,y)

+ return complex(x.re,-x.im)

+end

+

+function Complex.norm2(x)

+ local n=Complex.mul(x,Complex.conj(x))

+ return n.re

+end

+

+function Complex.abs(x)

+ return sqrt(Complex.norm2(x))

+end

+

+function Complex.add(x,y)

+ return complex(x.re+y.re,x.im+y.im)

+end

+

+function Complex.mul(x,y)

+ return complex(x.re*y.re-x.im*y.im,x.re*y.im+x.im*y.re)

+end

+

+Complex.metatable={

+	__add = Complex.add,

+	__mul = Complex.mul,

+}

+

+local function abs(x)

+ return math.sqrt(Complex.norm2(x))

+end

+

+xmin=-2.0	xmax=2.0	ymin=-2.0	ymax=2.0

+N=arg[1] or 256 

+

+function level(x,y)

+ local c=complex(x,y)

+ local l=0

+ local z=c

+ repeat

+  z=z*z+c

+  l=l+1

+ until abs(z)>2.0 or l>255

+ return l-1

+end

+

+dx=(xmax-xmin)/N

+dy=(ymax-ymin)/N

+

+print("P2")

+print("# mandelbrot set",xmin,xmax,ymin,ymax,N)

+print(N,N,255)

+local S = 0

+for i=1,N do

+ local x=xmin+(i-1)*dx

+ for j=1,N do

+  local y=ymin+(j-1)*dy

+  S = S + level(x,y)

+ end

+ -- if i % 10 == 0 then print(collectgarbage"count") end

+end

+print(S)

diff --git a/lua_benchmark/tests/Lua-Benchmarks/n-body.lua b/lua_benchmark/tests/Lua-Benchmarks/n-body.lua
new file mode 100644
index 0000000..40cee46
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/n-body.lua
@@ -0,0 +1,121 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+-- modified by Geoff Leyland
+-- modified by Mario Pernici
+
+sun = {}
+jupiter = {}
+saturn = {}
+uranus = {}
+neptune = {}
+
+local sqrt = math.sqrt
+
+local PI = 3.141592653589793
+local SOLAR_MASS = 4 * PI * PI
+local DAYS_PER_YEAR = 365.24
+sun.x = 0.0
+sun.y = 0.0
+sun.z = 0.0
+sun.vx = 0.0
+sun.vy = 0.0
+sun.vz = 0.0
+sun.mass = SOLAR_MASS
+jupiter.x = 4.84143144246472090e+00
+jupiter.y = -1.16032004402742839e+00
+jupiter.z = -1.03622044471123109e-01
+jupiter.vx = 1.66007664274403694e-03 * DAYS_PER_YEAR
+jupiter.vy = 7.69901118419740425e-03 * DAYS_PER_YEAR
+jupiter.vz = -6.90460016972063023e-05 * DAYS_PER_YEAR
+jupiter.mass = 9.54791938424326609e-04 * SOLAR_MASS
+saturn.x = 8.34336671824457987e+00
+saturn.y = 4.12479856412430479e+00
+saturn.z = -4.03523417114321381e-01
+saturn.vx = -2.76742510726862411e-03 * DAYS_PER_YEAR
+saturn.vy = 4.99852801234917238e-03 * DAYS_PER_YEAR
+saturn.vz = 2.30417297573763929e-05 * DAYS_PER_YEAR
+saturn.mass = 2.85885980666130812e-04 * SOLAR_MASS
+uranus.x = 1.28943695621391310e+01
+uranus.y = -1.51111514016986312e+01
+uranus.z = -2.23307578892655734e-01
+uranus.vx = 2.96460137564761618e-03 * DAYS_PER_YEAR
+uranus.vy = 2.37847173959480950e-03 * DAYS_PER_YEAR
+uranus.vz = -2.96589568540237556e-05 * DAYS_PER_YEAR
+uranus.mass = 4.36624404335156298e-05 * SOLAR_MASS
+neptune.x = 1.53796971148509165e+01
+neptune.y = -2.59193146099879641e+01
+neptune.z = 1.79258772950371181e-01
+neptune.vx = 2.68067772490389322e-03 * DAYS_PER_YEAR
+neptune.vy = 1.62824170038242295e-03 * DAYS_PER_YEAR
+neptune.vz = -9.51592254519715870e-05 * DAYS_PER_YEAR
+neptune.mass = 5.15138902046611451e-05 * SOLAR_MASS
+
+local bodies = {sun,jupiter,saturn,uranus,neptune}
+
+local function advance(bodies, nbody, dt)
+  for i=1,nbody do
+    local bi = bodies[i]
+    local bix, biy, biz, bimass = bi.x, bi.y, bi.z, bi.mass
+    local bivx, bivy, bivz = bi.vx, bi.vy, bi.vz
+    for j=i+1,nbody do
+      local bj = bodies[j]
+      local dx, dy, dz = bix-bj.x, biy-bj.y, biz-bj.z
+      local dist2 = dx*dx + dy*dy + dz*dz
+      local mag = sqrt(dist2)
+      mag = dt / (mag * dist2)
+      local bm = bj.mass*mag
+      bivx = bivx - (dx * bm)
+      bivy = bivy - (dy * bm)
+      bivz = bivz - (dz * bm)
+      bm = bimass*mag
+      bj.vx = bj.vx + (dx * bm)
+      bj.vy = bj.vy + (dy * bm)
+      bj.vz = bj.vz + (dz * bm)
+    end
+    bi.vx = bivx
+    bi.vy = bivy
+    bi.vz = bivz
+    bi.x = bix + dt * bivx
+    bi.y = biy + dt * bivy
+    bi.z = biz + dt * bivz
+  end
+end
+
+local function energy(bodies, nbody)
+  local e = 0
+  for i=1,nbody do
+    local bi = bodies[i]
+    local vx, vy, vz, bim = bi.vx, bi.vy, bi.vz, bi.mass
+    e = e + (0.5 * bim * (vx*vx + vy*vy + vz*vz))
+    for j=i+1,nbody do
+      local bj = bodies[j]
+      local dx, dy, dz = bi.x-bj.x, bi.y-bj.y, bi.z-bj.z
+      local distance = sqrt(dx*dx + dy*dy + dz*dz)
+      e = e - ((bim * bj.mass) / distance)
+    end
+  end
+  return e
+end
+
+local function offsetMomentum(b, nbody)
+  local px, py, pz = 0, 0, 0
+  for i=1,nbody do
+    local bi = b[i]
+    local bim = bi.mass
+    px = px + (bi.vx * bim)
+    py = py + (bi.vy * bim)
+    pz = pz + (bi.vz * bim)
+  end
+  b[1].vx = -px / SOLAR_MASS
+  b[1].vy = -py / SOLAR_MASS
+  b[1].vz = -pz / SOLAR_MASS
+end
+
+local N = tonumber(arg and arg[1]) or 1000
+local nbody = #bodies
+
+offsetMomentum(bodies, nbody)
+io.write( string.format("%0.9f",energy(bodies, nbody)), "\n")
+for i=1,N do advance(bodies, nbody, 0.01) end
+io.write( string.format("%0.9f",energy(bodies, nbody)), "\n")
diff --git a/lua_benchmark/tests/Lua-Benchmarks/plot.gpi b/lua_benchmark/tests/Lua-Benchmarks/plot.gpi
new file mode 100644
index 0000000..24277f4
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/plot.gpi
@@ -0,0 +1,18 @@
+set encoding utf8
+set terminal png size 3000,1000 font 'Helvetica,22'
+set output outfile
+
+set style data histogram
+set style histogram cluster gap 1
+set style fill solid border -1
+set xtic font "Helvetica,14"
+set boxwidth 0.9
+set grid
+set key bmargin center horizontal Left reverse noenhanced autotitle columnhead nobox
+set ylabel ylabel
+
+plot for[i=2:1 + nbinaries] datafile \
+    using i:xtic(1) \
+    title column \
+    ls i
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/qt.lua b/lua_benchmark/tests/Lua-Benchmarks/qt.lua
new file mode 100644
index 0000000..f1de543
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/qt.lua
@@ -0,0 +1,304 @@
+-- qt.lua,15 (one edge vector)

+-- Julia sets via interval cell-mapping (quadtree version)

+

+--require"julia" local f=f

+

+local io=io

+local root,exterior

+local cx,cy

+local Rxmin,Rxmax,Rymin,Rymax=-2.0,2.0,-2.0,2.0

+local white=1.0

+local black=0.0

+local gray=0.5

+local N=0

+local nE=0

+local E={}

+local write=io.write

+

+local function output(a1,a2,a3,a4,a5,a6)

+	write(

+	a1 or ""," ",

+	a2 or ""," ",

+	a3 or ""," ",

+	a4 or ""," ",

+	a5 or ""," ",

+	a6 or ""," \n")

+end

+

+local function imul(xmin,xmax,ymin,ymax)

+	local mm=xmin*ymin

+	local mM=xmin*ymax

+	local Mm=xmax*ymin

+	local MM=xmax*ymax

+	local m,M=mm,mm

+	if m>mM then m=mM elseif M<mM then M=mM end

+	if m>Mm then m=Mm elseif M<Mm then M=Mm end

+	if m>MM then m=MM elseif M<MM then M=MM end

+	return m,M

+end

+

+local function isqr(xmin,xmax)

+	local u=xmin*xmin

+	local v=xmax*xmax

+	if xmin<=0.0 and 0.0<=xmax then

+		if u<v then return 0.0,v else return 0.0,u end

+	else

+		if u<v then return u,v else return v,u end

+	end

+end

+

+local function f(xmin,xmax,ymin,ymax)

+	local x2min,x2max=isqr(xmin,xmax)

+	local y2min,y2max=isqr(ymin,ymax)

+	local xymin,xymax=imul(xmin,xmax,ymin,ymax)

+	return x2min-y2max+cx,x2max-y2min+cx,2.0*xymin+cy,2.0*xymax+cy

+end

+

+local function outside(xmin,xmax,ymin,ymax)

+	local x,y

+	if 0.0<xmin then x=xmin elseif 0.0<xmax then x=0.0 else x=xmax end

+	if 0.0<ymin then y=ymin elseif 0.0<ymax then y=0.0 else y=ymax end

+	return x^2+y^2>4.0

+end

+

+local function inside(xmin,xmax,ymin,ymax)

+	return	xmin^2+ymin^2<=4.0 and xmin^2+ymax^2<=4.0 and

+		xmax^2+ymin^2<=4.0 and xmax^2+ymax^2<=4.0

+end

+

+local function newcell()

+	return {nil,nil,nil,nil,color=gray}

+end

+

+local function addedge(a,b)

+	nE=nE+1

+	E[nE]=b

+end

+

+local function refine(q)

+	if q.color==gray then

+		if q[1]==nil then

+			q[1]=newcell()

+			q[2]=newcell()

+			q[3]=newcell()

+			q[4]=newcell()

+		else

+			refine(q[1])

+			refine(q[2])

+			refine(q[3])

+			refine(q[4])

+		end

+	end

+end

+

+local function clip(q,xmin,xmax,ymin,ymax,o,oxmin,oxmax,oymin,oymax)

+	local ixmin,ixmax,iymin,iymax

+	if xmin>oxmin then ixmin=xmin else ixmin=oxmin end

+	if xmax<oxmax then ixmax=xmax else ixmax=oxmax end

+	if ixmin>=ixmax then return end

+	if ymin>oymin then iymin=ymin else iymin=oymin end

+	if ymax<oymax then iymax=ymax else iymax=oymax end

+	--if ixmin<=ixmax and iymin<=iymax then

+	if iymin<iymax then

+		if q[1]==nil then

+			addedge(o,q)

+		else

+			local xmid=(xmin+xmax)/2.0

+			local ymid=(ymin+ymax)/2.0

+			clip(q[1],xmin,xmid,ymid,ymax,o,oxmin,oxmax,oymin,oymax)

+			clip(q[2],xmid,xmax,ymid,ymax,o,oxmin,oxmax,oymin,oymax)

+			clip(q[3],xmin,xmid,ymin,ymid,o,oxmin,oxmax,oymin,oymax)

+			clip(q[4],xmid,xmax,ymin,ymid,o,oxmin,oxmax,oymin,oymax)

+		end

+	end

+end

+

+local function map(q,xmin,xmax,ymin,ymax)

+	--xmin,xmax,ymin,ymax=f(xmin,xmax,ymin,ymax,cx,cy)

+	xmin,xmax,ymin,ymax=f(xmin,xmax,ymin,ymax)

+	if outside(xmin,xmax,ymin,ymax) then

+		q.color=white

+	else

+		if not inside(xmin,xmax,ymin,ymax) then addedge(q,exterior) end

+		clip(root,Rxmin,Rxmax,Rymin,Rymax,q,xmin,xmax,ymin,ymax)

+	end

+end

+

+local function update(q,xmin,xmax,ymin,ymax)

+	if q.color==gray then

+		if q[1]==nil then

+			local b=nE

+			q[2]=nE+1

+			map(q,xmin,xmax,ymin,ymax)

+			q[3]=nE

+		else

+			local xmid=(xmin+xmax)/2.0

+			local ymid=(ymin+ymax)/2.0

+			update(q[1],xmin,xmid,ymid,ymax)

+			update(q[2],xmid,xmax,ymid,ymax)

+			update(q[3],xmin,xmid,ymin,ymid)

+			update(q[4],xmid,xmax,ymin,ymid)

+		end

+	end

+end

+

+local function color(q)

+	if q.color==gray then

+		if q[1]==nil then

+			for i=q[2],q[3] do

+				if E[i].color~=white then return end

+			end

+			q.color=white N=N+1

+		else

+			color(q[1])

+			color(q[2])

+			color(q[3])

+			color(q[4])

+		end

+	end

+end

+

+local function prewhite(q)

+	if q.color==gray then

+		if q[1]==nil then

+			for i=q[2],q[3] do

+				local c=E[i].color

+				if c==white or c==-gray then

+					q.color=-gray

+					N=N+1

+					return

+				end

+			end

+		else

+			prewhite(q[1])

+			prewhite(q[2])

+			prewhite(q[3])

+			prewhite(q[4])

+		end

+	end

+end

+

+local function recolor(q)

+	if q.color==-gray then

+		q.color=gray

+	elseif q.color==gray then

+		if q[1]==nil then

+			q.color=black

+		else

+			recolor(q[1])

+			recolor(q[2])

+			recolor(q[3])

+			recolor(q[4])

+		end

+	end

+end

+

+local function area(q)

+	if q[1]==nil then

+		if q.color==white then return 0.0,0.0

+		elseif q.color==black then return 0.0,1.0

+		else return 1.0,0.0 end

+	else

+		local g1,b1=area(q[1])

+		local g2,b2=area(q[2])

+		local g3,b3=area(q[3])

+		local g4,b4=area(q[4])

+		return (g1+g2+g3+g4)/4.0, (b1+b2+b3+b4)/4.0

+	end

+end

+

+local function colorup(q)

+	if q[1]~=nil and q.color==gray then

+		local c1=colorup(q[1])

+		local c2=colorup(q[2])

+		local c3=colorup(q[3])

+		local c4=colorup(q[4])

+		if c1==c2 and c1==c3 and c1==c4 then

+if c1~=gray then

+			q[1]=nil; --q[2]=nil; q[3]=nil; q[4]=nil

+N=N+1 end

+			q.color=c1

+		end

+	end

+	return q.color

+end

+

+local function save(q,xmin,ymin,N)

+	if q[1]==nil or N==1 then

+		output(xmin,ymin,N,q.color)

+	else

+		N=N/2

+		local xmid=xmin+N

+		local ymid=ymin+N

+		save(q[1],xmin,ymin,N)

+		save(q[2],xmid,ymin,N)

+		save(q[3],xmin,ymid,N)

+		save(q[4],xmid,ymid,N)

+	end

+end

+local function show(p)

+	local N=2^10

+	-- io.output(p..".box")

+	output(N)

+	save(root,0,0,N)

+	-- io.close()

+end

+

+local t0=0

+local function memory(s)

+	local t=os.clock()

+	--local dt=string.format("%f",t-t0)

+	local dt=t-t0

+	io.stdout:write(s,"\t",dt," sec\t",t," sec\t",math.floor(collectgarbage"count"/1024),"M\n")

+	t0=t

+end

+

+local function do_(f,s)

+	local a,b=f(root,Rxmin,Rxmax,Rymin,Rymax)

+	memory(s)

+	return a,b

+end

+

+local function julia(l,a,b)

+memory"begin"

+	cx=a	cy=b

+	root=newcell()

+	exterior=newcell()	exterior.color=white

+	show(0)

+	for i=1,l do print("\nstep",i)

+		nE=0

+		do_(refine,"refine")

+		do_(update,"update")

+		repeat

+			N=0 color(root,Rxmin,Rxmax,Rymin,Rymax) print("color",N)

+		until N==0 memory"color"

+		repeat

+			N=0 prewhite(root,Rxmin,Rxmax,Rymin,Rymax) print("prewhite",N)

+		until N==0 memory"prewhite"

+		do_(recolor,"recolor")

+		do_(colorup,"colorup")		print("colorup",N)

+		local g,b=do_(area,"area")	print("area",g,b,g+b)

+		show(i) memory"output"

+	print("edges",nE)

+	end

+end

+

+--julia(14,0.25,0.35)

+--julia(14, -.12, .74 )

+--julia(14,0,0)

+--julia(12,0.25,0)

+--julia(9,0.24,0)

+--julia(9,0.26,0)

+--julia(13,0,1)

+--julia(12,-1.1,0)

+--julia(9,-0.12,0.5)

+

+-- figures for paper

+--julia(14,0,1)

+--julia(14,-1,0)

+--julia(12,-0.12, 0.64)

+--julia(14,-0.12, 0.60)

+--julia(14,-0.12, 0.30)

+

+-- julia (level, a, b) -- julia set de c= a + b i

+julia(10,-0.25, 0.74)

diff --git a/lua_benchmark/tests/Lua-Benchmarks/queen.lua b/lua_benchmark/tests/Lua-Benchmarks/queen.lua
new file mode 100644
index 0000000..9071406
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/queen.lua
@@ -0,0 +1,46 @@
+local N = tonumber(arg[1] or 8)    -- board size

+

+

+-- check whether position (n,c) is free from attacks

+local function isplaceok (a, n, c)

+  for i = 1, n - 1 do   -- for each queen already placed

+    if (a[i] == c) or                -- same column?

+       (a[i] - i == c - n) or        -- same diagonal?

+       (a[i] + i == c + n) then      -- same diagonal?

+      return false            -- place can be attacked

+    end

+  end

+  return true    -- no attacks; place is OK

+end

+

+

+-- print a board

+local function printsolution (a)

+  for i = 1, N do

+    for j = 1, N do

+      io.write(a[i] == j and "X" or "-", " ")

+    end

+    io.write("\n")

+  end

+  io.write("\n")

+end

+

+

+-- add to board 'a' all queens from 'n' to 'N'

+local function addqueen (a, n)

+  if n > N then    -- all queens have been placed?

+    printsolution(a)

+  else  -- try to place n-th queen

+    for c = 1, N do

+      if isplaceok(a, n, c) then

+        a[n] = c    -- place n-th queen at column 'c'

+        addqueen(a, n + 1)

+      end

+    end

+  end

+end

+

+

+-- run the program

+addqueen({}, 1)

+

diff --git a/lua_benchmark/tests/Lua-Benchmarks/readme.md b/lua_benchmark/tests/Lua-Benchmarks/readme.md
new file mode 100644
index 0000000..b1b6624
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/readme.md
@@ -0,0 +1,31 @@
+# Lua Benchmarks
+
+Compare the performance of different Lua implementations
+
+## Sample Results
+
+Computer information:
+
+```
+Distro: CentOS release 6.8 (Final)
+Kernel: 2.6.32-642.13.1.el6.x86_64
+CPU:    Intel(R) Core(TM) i7-4770 CPU @ 3.40GHz
+```
+![](https://raw.githubusercontent.com/gligneul/Lua-Benchmarks/master/results/speedup_luajit.png)
+![](https://raw.githubusercontent.com/gligneul/Lua-Benchmarks/master/results/speedup_lua53.png)
+![](https://raw.githubusercontent.com/gligneul/Lua-Benchmarks/master/results/speedup_lua5.png)
+
+## Usage
+
+```
+usage: lua runbenchmarks.lua [options]
+options:
+    --nruns <n>      number of times that each test is executed (default = 3)
+    --no-supress     don't supress error messages from tests
+    --output <name>  name of the benchmark output
+    --normalize      normalize the result based on the first binary
+    --speedup        compute the speedup based on the first binary
+    --no-plot        don't create the plot with gnuplot
+    --help           show this message
+```
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/regex-dna.lua b/lua_benchmark/tests/Lua-Benchmarks/regex-dna.lua
new file mode 100644
index 0000000..2627e05
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/regex-dna.lua
@@ -0,0 +1,59 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Jim Roseborough
+-- modified by Victor Tang
+-- optimized & replaced inefficient use of gsub with gmatch
+-- partitioned sequence to prevent extraneous redundant string copy
+
+seq = io.read("*a")
+ilen, seq = #seq, seq:gsub('>[^%c]*%c*', ''):gsub('%c+', '')
+clen = #seq
+
+local variants = { 'agggtaaa|tttaccct',
+                   '[cgt]gggtaaa|tttaccc[acg]',
+                   'a[act]ggtaaa|tttacc[agt]t',
+                   'ag[act]gtaaa|tttac[agt]ct',
+                   'agg[act]taaa|ttta[agt]cct',
+                   'aggg[acg]aaa|ttt[cgt]ccct',
+                   'agggt[cgt]aa|tt[acg]accct',
+                   'agggta[cgt]a|t[acg]taccct',
+                   'agggtaa[cgt]|[acg]ttaccct', }
+
+local subst = { B='(c|g|t)', D='(a|g|t)',   H='(a|c|t)', K='(g|t)',
+                M='(a|c)',   N='(a|c|g|t)', R='(a|g)',   S='(c|g)',
+                V='(a|c|g)', W='(a|t)',     Y='(c|t)' }
+
+function countmatches(variant)
+   local n = 0
+   variant:gsub('([^|]+)|?', function(pattern)
+      for _ in seq:gmatch(pattern) do n = n + 1 end
+   end)
+   return n
+end
+
+for _, p in ipairs(variants) do
+   io.write( string.format('%s %d\n', p, countmatches(p)) )
+end
+
+function partitionstring(seq)
+  local seg = math.floor( math.sqrt(#seq) )
+  local seqtable = {}
+  for nextstart = 1, #seq, seg do
+    table.insert(seqtable, seq:sub(nextstart, nextstart + seg - 1))
+  end
+  return seqtable
+end
+function chunk_gsub(t, k, v)
+  for i, p in ipairs(t) do
+    t[i] = p:find(k) and p:gsub(k, v) or t[i]
+  end
+  return t
+end
+
+seq = partitionstring(seq)
+for k, v in pairs(subst) do
+  chunk_gsub(seq, k, v)
+end
+seq = table.concat(seq)
+io.write(string.format('\n%d\n%d\n%d\n', ilen, clen, #seq))
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.png b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.png
new file mode 100644
index 0000000..3a96c4b
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.png
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.txt
new file mode 100644
index 0000000..4229164
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.txt
@@ -0,0 +1,14 @@
+test	lua-5.1.5	lua-5.2.4	lua-5.3.4	
+ack	1.0	1.0106382978723	1.0249494268375	
+fixpoint-fact	1.0	0.87217724755006	0.93172507965407	
+heapsort	1.0	0.67983128834356	1.0497335701599	
+mandelbrot	1.0	0.9497287522604	1.1796945193172	
+juliaset	1.0	0.90391321193336	1.0648105887723	
+queen	1.0	0.82105263157895	1.0067934782609	
+sieve	1.0	0.93239227340267	1.2178554099951	
+binary	1.0	1.9514442231076	1.3708238586671	
+n-body	1.0	0.90884932234919	1.2101910828025	
+fannkuch	1.0	0.80147058823529	1.1354166666667	
+fasta	1.0	0.93725490196078	0.91483253588517	
+k-nucleotide	1.0	0.95159059474412	1.0747201249675	
+spectral-norm	1.0	0.93865698729583	0.97695504344541	
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.png b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.png
new file mode 100644
index 0000000..a701896
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.png
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.txt
new file mode 100644
index 0000000..162511f
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.txt
@@ -0,0 +1,14 @@
+test	lua-5.3.0	lua-5.3.1	lua-5.3.2	lua-5.3.3	lua-5.3.4	
+ack	1.0	1.0047169811321	1.0142857142857	1.0205338809035	1.0060728744939	
+fixpoint-fact	1.0	0.98553429771349	0.98050139275766	0.94496644295302	0.94538943598926	
+heapsort	1.0	0.93150999770168	1.1819772528434	1.2005331753555	1.1812882541533	
+mandelbrot	1.0	0.96816037735849	1.1200545702592	1.1439851370181	1.1000446627959	
+juliaset	1.0	0.95912698412698	1.0563811188811	1.0431592576608	1.1247091670544	
+queen	1.0	0.96021908330931	1.1372482075794	1.1411442274752	1.1318382602786	
+sieve	1.0	0.98799039231385	1.1808612440191	1.1963160445952	1.1836930455635	
+binary	1.0	1.0183116645303	1.011458712259	1.0568225009502	1.0275314116778	
+n-body	1.0	0.96153846153846	1.1900714042843	1.2608069164265	1.2169680111266	
+fannkuch	1.0	0.96326981496824	1.2090121317158	1.2183024799162	1.2106907323846	
+fasta	1.0	0.96836313617607	1.0004737091426	1.0095602294455	1.0114942528736	
+k-nucleotide	1.0	1.0283306017326	1.0588235294118	1.1467362924282	1.1683958499601	
+spectral-norm	1.0	0.98923646148671	1.1707802547771	1.1372776488786	1.1320246343341	
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53_log.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53_log.txt
new file mode 100644
index 0000000..e2ff8a4
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53_log.txt
@@ -0,0 +1,69 @@
+Distro: CentOS release 6.8 (Final)
+Kernel: 2.6.32-642.13.1.el6.x86_64
+CPU:    Intel(R) Core(TM) i7-4770 CPU @ 3.40GHz
+running "lua-5.3.0 ./ack.lua 3 10"... done
+running "lua-5.3.1 ./ack.lua 3 10"... done
+running "lua-5.3.2 ./ack.lua 3 10"... done
+running "lua-5.3.3 ./ack.lua 3 10"... done
+running "lua ./ack.lua 3 10"... done
+running "lua-5.3.0 ./fixpoint-fact.lua 3000"... done
+running "lua-5.3.1 ./fixpoint-fact.lua 3000"... done
+running "lua-5.3.2 ./fixpoint-fact.lua 3000"... done
+running "lua-5.3.3 ./fixpoint-fact.lua 3000"... done
+running "lua ./fixpoint-fact.lua 3000"... done
+running "lua-5.3.0 ./heapsort.lua 10 250000"... done
+running "lua-5.3.1 ./heapsort.lua 10 250000"... done
+running "lua-5.3.2 ./heapsort.lua 10 250000"... done
+running "lua-5.3.3 ./heapsort.lua 10 250000"... done
+running "lua ./heapsort.lua 10 250000"... done
+running "lua-5.3.0 ./mandel.lua"... done
+running "lua-5.3.1 ./mandel.lua"... done
+running "lua-5.3.2 ./mandel.lua"... done
+running "lua-5.3.3 ./mandel.lua"... done
+running "lua ./mandel.lua"... done
+running "lua-5.3.0 ./qt.lua"... done
+running "lua-5.3.1 ./qt.lua"... done
+running "lua-5.3.2 ./qt.lua"... done
+running "lua-5.3.3 ./qt.lua"... done
+running "lua ./qt.lua"... done
+running "lua-5.3.0 ./queen.lua 12"... done
+running "lua-5.3.1 ./queen.lua 12"... done
+running "lua-5.3.2 ./queen.lua 12"... done
+running "lua-5.3.3 ./queen.lua 12"... done
+running "lua ./queen.lua 12"... done
+running "lua-5.3.0 ./sieve.lua 5000"... done
+running "lua-5.3.1 ./sieve.lua 5000"... done
+running "lua-5.3.2 ./sieve.lua 5000"... done
+running "lua-5.3.3 ./sieve.lua 5000"... done
+running "lua ./sieve.lua 5000"... done
+running "lua-5.3.0 ./binary-trees.lua 15"... done
+running "lua-5.3.1 ./binary-trees.lua 15"... done
+running "lua-5.3.2 ./binary-trees.lua 15"... done
+running "lua-5.3.3 ./binary-trees.lua 15"... done
+running "lua ./binary-trees.lua 15"... done
+running "lua-5.3.0 ./n-body.lua 1000000"... done
+running "lua-5.3.1 ./n-body.lua 1000000"... done
+running "lua-5.3.2 ./n-body.lua 1000000"... done
+running "lua-5.3.3 ./n-body.lua 1000000"... done
+running "lua ./n-body.lua 1000000"... done
+running "lua-5.3.0 ./fannkuch-redux.lua 10"... done
+running "lua-5.3.1 ./fannkuch-redux.lua 10"... done
+running "lua-5.3.2 ./fannkuch-redux.lua 10"... done
+running "lua-5.3.3 ./fannkuch-redux.lua 10"... done
+running "lua ./fannkuch-redux.lua 10"... done
+running "lua-5.3.0 ./fasta.lua 2500000"... done
+running "lua-5.3.1 ./fasta.lua 2500000"... done
+running "lua-5.3.2 ./fasta.lua 2500000"... done
+running "lua-5.3.3 ./fasta.lua 2500000"... done
+running "lua ./fasta.lua 2500000"... done
+running "lua-5.3.0 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.3.1 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.3.2 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.3.3 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.3.0 ./spectral-norm.lua 1000"... done
+running "lua-5.3.1 ./spectral-norm.lua 1000"... done
+running "lua-5.3.2 ./spectral-norm.lua 1000"... done
+running "lua-5.3.3 ./spectral-norm.lua 1000"... done
+running "lua ./spectral-norm.lua 1000"... done
+final done
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5_log.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5_log.txt
new file mode 100644
index 0000000..96d8a9f
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5_log.txt
@@ -0,0 +1,43 @@
+Distro: CentOS release 6.8 (Final)
+Kernel: 2.6.32-642.13.1.el6.x86_64
+CPU:    Intel(R) Core(TM) i7-4770 CPU @ 3.40GHz
+running "lua-5.1.5 ./ack.lua 3 10"... done
+running "lua-5.2.4 ./ack.lua 3 10"... done
+running "lua ./ack.lua 3 10"... done
+running "lua-5.1.5 ./fixpoint-fact.lua 3000"... done
+running "lua-5.2.4 ./fixpoint-fact.lua 3000"... done
+running "lua ./fixpoint-fact.lua 3000"... done
+running "lua-5.1.5 ./heapsort.lua 10 250000"... done
+running "lua-5.2.4 ./heapsort.lua 10 250000"... done
+running "lua ./heapsort.lua 10 250000"... done
+running "lua-5.1.5 ./mandel.lua"... done
+running "lua-5.2.4 ./mandel.lua"... done
+running "lua ./mandel.lua"... done
+running "lua-5.1.5 ./qt.lua"... done
+running "lua-5.2.4 ./qt.lua"... done
+running "lua ./qt.lua"... done
+running "lua-5.1.5 ./queen.lua 12"... done
+running "lua-5.2.4 ./queen.lua 12"... done
+running "lua ./queen.lua 12"... done
+running "lua-5.1.5 ./sieve.lua 5000"... done
+running "lua-5.2.4 ./sieve.lua 5000"... done
+running "lua ./sieve.lua 5000"... done
+running "lua-5.1.5 ./binary-trees.lua 15"... done
+running "lua-5.2.4 ./binary-trees.lua 15"... done
+running "lua ./binary-trees.lua 15"... done
+running "lua-5.1.5 ./n-body.lua 1000000"... done
+running "lua-5.2.4 ./n-body.lua 1000000"... done
+running "lua ./n-body.lua 1000000"... done
+running "lua-5.1.5 ./fannkuch-redux.lua 10"... done
+running "lua-5.2.4 ./fannkuch-redux.lua 10"... done
+running "lua ./fannkuch-redux.lua 10"... done
+running "lua-5.1.5 ./fasta.lua 2500000"... done
+running "lua-5.2.4 ./fasta.lua 2500000"... done
+running "lua ./fasta.lua 2500000"... done
+running "lua-5.1.5 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.2.4 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.1.5 ./spectral-norm.lua 1000"... done
+running "lua-5.2.4 ./spectral-norm.lua 1000"... done
+running "lua ./spectral-norm.lua 1000"... done
+final done
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.png b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.png
new file mode 100644
index 0000000..6f012f5
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.png
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.txt
new file mode 100644
index 0000000..c2931b9
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.txt
@@ -0,0 +1,14 @@
+test	lua-5.3.4	luajit-2.0.4-interp	luajit-2.0.4	
+ack	1.0	2.5783972125436	11.472868217054	
+fixpoint-fact	1.0	2.5550351288056	2.5580304806565	
+heapsort	1.0	2.0149880095923	5.3264659270998	
+mandelbrot	1.0	2.0203703703704	18.491525423729	
+juliaset	1.0	2.186790505676	3.4851973684211	
+queen	1.0	2.1812080536913	11.746987951807	
+sieve	1.0	1.7278056951424	10.26368159204	
+binary	1.0	3.3795359904819	4.3333333333333	
+n-body	1.0	2.279702970297	14.854838709677	
+fannkuch	1.0	2.1797410510282	8.9158878504673	
+fasta	1.0	1.6870474658085	3.460396039604	
+k-nucleotide	1.0	1.7326325411335	3.276577355229	
+spectral-norm	1.0	2.2377260981912	17.673469387755	
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit_log.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit_log.txt
new file mode 100644
index 0000000..24fa930
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit_log.txt
@@ -0,0 +1,43 @@
+Distro: CentOS release 6.8 (Final)
+Kernel: 2.6.32-642.13.1.el6.x86_64
+CPU:    Intel(R) Core(TM) i7-4770 CPU @ 3.40GHz
+running "lua ./ack.lua 3 10"... done
+running "luajit -joff ./ack.lua 3 10"... done
+running "luajit ./ack.lua 3 10"... done
+running "lua ./fixpoint-fact.lua 3000"... done
+running "luajit -joff ./fixpoint-fact.lua 3000"... done
+running "luajit ./fixpoint-fact.lua 3000"... done
+running "lua ./heapsort.lua 10 250000"... done
+running "luajit -joff ./heapsort.lua 10 250000"... done
+running "luajit ./heapsort.lua 10 250000"... done
+running "lua ./mandel.lua"... done
+running "luajit -joff ./mandel.lua"... done
+running "luajit ./mandel.lua"... done
+running "lua ./qt.lua"... done
+running "luajit -joff ./qt.lua"... done
+running "luajit ./qt.lua"... done
+running "lua ./queen.lua 12"... done
+running "luajit -joff ./queen.lua 12"... done
+running "luajit ./queen.lua 12"... done
+running "lua ./sieve.lua 5000"... done
+running "luajit -joff ./sieve.lua 5000"... done
+running "luajit ./sieve.lua 5000"... done
+running "lua ./binary-trees.lua 15"... done
+running "luajit -joff ./binary-trees.lua 15"... done
+running "luajit ./binary-trees.lua 15"... done
+running "lua ./n-body.lua 1000000"... done
+running "luajit -joff ./n-body.lua 1000000"... done
+running "luajit ./n-body.lua 1000000"... done
+running "lua ./fannkuch-redux.lua 10"... done
+running "luajit -joff ./fannkuch-redux.lua 10"... done
+running "luajit ./fannkuch-redux.lua 10"... done
+running "lua ./fasta.lua 2500000"... done
+running "luajit -joff ./fasta.lua 2500000"... done
+running "luajit ./fasta.lua 2500000"... done
+running "lua ./k-nucleotide.lua < fasta1000000.txt"... done
+running "luajit -joff ./k-nucleotide.lua < fasta1000000.txt"... done
+running "luajit ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua ./spectral-norm.lua 1000"... done
+running "luajit -joff ./spectral-norm.lua 1000"... done
+running "luajit ./spectral-norm.lua 1000"... done
+final done
diff --git a/lua_benchmark/tests/Lua-Benchmarks/runbenchmarks.lua b/lua_benchmark/tests/Lua-Benchmarks/runbenchmarks.lua
new file mode 100755
index 0000000..dafbb3e
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/runbenchmarks.lua
@@ -0,0 +1,234 @@
+#!/bin/env lua
+
+-- Configuration ---------------------------------------------------------------
+
+-- List of binaries that will be tested
+local binaries = {
+    { 'lua-5.3.4', 'lua' },
+    { 'luajit-2.0.4-interp', 'luajit -joff' },
+    { 'luajit-2.0.4', 'luajit' },
+}
+
+-- List of tests
+local tests_root = './'
+local tests = {
+    { 'ack', 'ack.lua 3 10' },
+    { 'fixpoint-fact', 'fixpoint-fact.lua 3000' },
+    { 'heapsort', 'heapsort.lua 10 250000' },
+    { 'mandelbrot', 'mandel.lua' },
+    { 'juliaset', 'qt.lua' },
+    { 'queen', 'queen.lua 12' },
+    { 'sieve', 'sieve.lua 5000' }, -- Sieve of Eratosthenes
+    { 'binary', 'binary-trees.lua 15' },
+    { 'n-body', 'n-body.lua 1000000' },
+    { 'fannkuch', 'fannkuch-redux.lua 10' },
+    { 'fasta', 'fasta.lua 2500000' },
+    { 'k-nucleotide', 'k-nucleotide.lua < fasta1000000.txt' },
+    --{ 'regex-dna', 'regex-dna.lua < fasta1000000.txt' },
+    { 'spectral-norm', 'spectral-norm.lua 1000' },
+}
+
+-- Command line arguments ------------------------------------------------------
+
+local nruns = 3
+local supress_errors = true 
+local basename = 'results'
+local normalize = false
+local speedup = false
+local plot = true
+
+local usage = [[
+usage: lua ]] .. arg[0] .. [[ [options]
+options:
+    --nruns <n>      number of times that each test is executed (default = 3)
+    --no-supress     don't supress error messages from tests
+    --output <name>  name of the benchmark output
+    --normalize      normalize the result based on the first binary
+    --speedup        compute the speedup based on the first binary
+    --no-plot        don't create the plot with gnuplot
+    --help           show this message
+]]
+
+local function parse_args()
+    local function parse_error(msg)
+        print('Error: ' .. msg .. '\n' .. usage)
+        os.exit(1)
+    end
+    local function get_next_arg(i)
+        if i + 1 > #arg then
+            parse_error(arg[i] .. ' requires a value')
+        end
+        local v = arg[i + 1]
+        arg[i + 1] = nil
+        return v
+    end
+    for i = 1, #arg do
+        if not arg[i] then goto continue end
+        if arg[i] == '--nruns' then
+            nruns = tonumber(get_next_arg(i))
+            if not nruns or nruns < 1 then
+                parse_error('nruns should be a number greater than 1')
+            end
+        elseif arg[i] == '--no-supress' then
+            supress_errors = false
+        elseif arg[i] == '--output' then
+            basename = get_next_arg(i)
+        elseif arg[i] == '--normalize' then
+            normalize = true
+        elseif arg[i] == '--speedup' then
+            speedup = true
+        elseif arg[i] == '--no-plot' then
+            plot = false
+        elseif arg[i] == '--help' then
+            print(usage)
+            os.exit()
+        else
+            parse_error('invalid argument: ' .. arg[i])
+        end
+        ::continue::
+    end
+end
+
+-- Implementation --------------------------------------------------------------
+
+-- Run the command a single time and returns the time elapsed
+local function measure(cmd)
+    local time_cmd = '{ TIMEFORMAT=\'%3R\'; time ' ..  cmd ..
+            ' > /dev/null; } 2>&1'
+    local handle = io.popen(time_cmd)
+    local result = handle:read("*a")
+    local time_elapsed = tonumber(result)
+    handle:close()
+    if not time_elapsed then
+        error('Invalid output for "' .. cmd .. '":\n' .. result)
+    end
+    return time_elapsed
+end
+
+-- Run the command $nruns and return the fastest time
+local function benchmark(cmd)
+    local min = 999
+    io.write('running "' .. cmd .. '"... ')
+    for _ = 1, nruns do
+        local time = measure(cmd)
+        min = math.min(min, time)
+    end
+    io.write('done\n')
+    return min
+end
+
+-- Create a matrix with n rows
+local function create_matrix(n)
+    local m = {}
+    for i = 1, n do
+        m[i] = {}
+    end
+    return m
+end
+
+-- Measure the time for each binary and test
+-- Return a matrix with the result (test x binary)
+local function run_all()
+    local results = create_matrix(#tests)
+    for i, test in ipairs(tests) do
+        local test_path = tests_root .. test[2]
+        for j, binary in ipairs(binaries) do
+            local cmd = binary[2] .. ' ' .. test_path
+            local ok, msg = pcall(function()
+                results[i][j] = benchmark(cmd)
+            end)
+            if not ok and not supress_errors then
+                io.write('error:\n' .. msg .. '\n---\n')
+            end
+        end
+    end
+    return results 
+end
+
+-- Perform an operation for each value in the matrix
+local function process_results(results, f)
+    for _, line in ipairs(results) do
+        local base = line[1]
+        for i = 1, #binaries do
+            line[i] = f(line[i], base)
+        end
+    end
+end
+
+-- Print info about the host computer
+local function computer_info()
+    os.execute([[
+echo "Distro: "`cat /etc/*-release | head -1`
+echo "Kernel: "`uname -r`
+echo "CPU:    "`cat /proc/cpuinfo | grep 'model name' | tail -1 | \
+                sed 's/model name.*:.//'`]])
+end
+
+-- Creates and saves the gnuplot data file
+local function create_data_file(results)
+    local data = 'test\t'
+    for _, binary in ipairs(binaries) do
+        data = data .. binary[1] .. '\t'
+    end
+    data = data .. '\n'
+    for i, test in ipairs(tests) do
+        data = data .. test[1] .. '\t'
+        for j, _ in ipairs(binaries) do
+            data = data .. results[i][j] .. '\t' 
+        end
+        data = data .. '\n'
+    end
+    io.open(basename .. '.txt', 'w'):write(data):close()
+end
+
+-- Generates the output image with gnuplot
+local function generate_image()
+    local ylabel
+    if normalize then
+        ylabel = 'Normalized time'
+    elseif speedup then
+        ylabel = 'Speedup'
+    else
+        ylabel = 'Elapsed time'
+    end
+    os.execute('gnuplot -e "datafile=\'' .. basename .. '.txt\'" ' ..
+               '-e "outfile=\'' .. basename .. '.png\'" ' ..
+               '-e "ylabel=\'' .. ylabel .. '\'" ' ..
+               '-e "nbinaries=' .. #binaries .. '" plot.gpi')
+end
+
+local function setup()
+    os.execute('luajit ' .. tests_root .. 'fasta.lua 1000000 > fasta1000000.txt')
+end
+
+local function teardown()
+    os.execute('rm fasta1000000.txt')
+end
+
+local function main()
+    parse_args()
+    computer_info()
+    setup()
+    local results = run_all()
+    teardown()
+    local function f(v, base)
+        if not v then
+            return 0
+        elseif not base then
+            return v
+        elseif speedup then
+            return base / v
+        elseif normalize then
+            return v / base
+        else
+            return v
+        end
+    end
+    process_results(results, f)
+    create_data_file(results)
+    if plot then generate_image() end
+    print('final done')
+end
+
+main()
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/scimark.lua b/lua_benchmark/tests/Lua-Benchmarks/scimark.lua
new file mode 100644
index 0000000..b833b30
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/scimark.lua
@@ -0,0 +1,433 @@
+------------------------------------------------------------------------------
+-- Lua SciMark (2010-12-20).
+--
+-- A literal translation of SciMark 2.0a, written in Java and C.
+-- Credits go to the original authors Roldan Pozo and Bruce Miller.
+-- See: http://math.nist.gov/scimark2/
+------------------------------------------------------------------------------
+-- Copyright (C) 2006-2010 Mike Pall. All rights reserved.
+--
+-- Permission is hereby granted, free of charge, to any person obtaining
+-- a copy of this software and associated documentation files (the
+-- "Software"), to deal in the Software without restriction, including
+-- without limitation the rights to use, copy, modify, merge, publish,
+-- distribute, sublicense, and/or sell copies of the Software, and to
+-- permit persons to whom the Software is furnished to do so, subject to
+-- the following conditions:
+--
+-- The above copyright notice and this permission notice shall be
+-- included in all copies or substantial portions of the Software.
+--
+-- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+-- EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+-- MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+-- IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+-- CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+-- TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+-- SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+--
+-- [ MIT license: http://www.opensource.org/licenses/mit-license.php ]
+------------------------------------------------------------------------------
+
+------------------------------------------------------------------------------
+-- Modificatin to be compatible with Lua 5.3
+------------------------------------------------------------------------------
+
+if table and table.unpack then
+    unpack = table.unpack
+end
+
+------------------------------------------------------------------------------
+
+local SCIMARK_VERSION = "2010-12-10"
+local SCIMARK_COPYRIGHT = "Copyright (C) 2006-2010 Mike Pall"
+
+local MIN_TIME = 2.0
+local RANDOM_SEED = 101009 -- Must be odd.
+local SIZE_SELECT = "small"
+
+local benchmarks = {
+  "FFT", "SOR", "MC", "SPARSE", "LU",
+  small = {
+    FFT		= { 1024 },
+    SOR		= { 100 },
+    MC		= { },
+    SPARSE	= { 1000, 5000 },
+    LU		= { 100 },
+  },
+  large = {
+    FFT		= { 1048576 },
+    SOR		= { 1000 },
+    MC		= { },
+    SPARSE	= { 100000, 1000000 },
+    LU		= { 1000 },
+  },
+}
+
+local abs, log, sin, floor = math.abs, math.log, math.sin, math.floor
+local pi, clock = math.pi, os.clock
+local format = string.format
+
+------------------------------------------------------------------------------
+-- Select array type: Lua tables or native (FFI) arrays
+------------------------------------------------------------------------------
+
+local darray, iarray
+
+local function array_init()
+  if jit and jit.status and jit.status() then
+    local ok, ffi = pcall(require, "ffi")
+    if ok then
+      darray = ffi.typeof("double[?]")
+      iarray = ffi.typeof("int[?]")
+      return
+    end
+  end
+  function darray(n) return {} end
+  iarray = darray
+end
+
+------------------------------------------------------------------------------
+-- This is a Lagged Fibonacci Pseudo-random Number Generator with
+-- j, k, M = 5, 17, 31. Pretty weak, but same as C/Java SciMark.
+------------------------------------------------------------------------------
+
+local rand, rand_init
+
+if jit and jit.status and jit.status() then
+  -- LJ2 has bit operations and zero-based arrays (internally).
+  local bit = require("bit")
+  local band, sar = bit.band, bit.arshift
+  function rand_init(seed)
+    local Rm, Rj, Ri = iarray(17), 16, 11
+    for i=0,16 do Rm[i] = 0 end
+    for i=16,0,-1 do
+      seed = band(seed*9069, 0x7fffffff)
+      Rm[i] = seed
+    end
+    function rand()
+      local i = band(Ri+1, sar(Ri-16, 31))
+      local j = band(Rj+1, sar(Rj-16, 31))
+      Ri, Rj = i, j
+      local k = band(Rm[i] - Rm[j], 0x7fffffff)
+      Rm[j] = k
+      return k * (1.0/2147483647.0)
+    end
+  end
+else
+  -- Better for standard Lua with one-based arrays and without bit operations.
+  function rand_init(seed)
+    local Rm, Rj = {}, 1
+    for i=1,17 do Rm[i] = 0 end
+    for i=17,1,-1 do
+      seed = (seed*9069) % (2^31)
+      Rm[i] = seed
+    end
+    function rand()
+      local j, m = Rj, Rm
+      local h = j - 5
+      if h < 1 then h = h + 17 end
+      local k = m[h] - m[j]
+      if k < 0 then k = k + 2147483647 end
+      m[j] = k
+      if j < 17 then Rj = j + 1 else Rj = 1 end
+      return k * (1.0/2147483647.0)
+    end
+  end
+end
+
+local function random_vector(n)
+  local v = darray(n+1)
+  for x=1,n do v[x] = rand() end
+  return v
+end
+
+local function random_matrix(m, n)
+  local a = {}
+  for y=1,m do
+    local v = darray(n+1)
+    a[y] = v
+    for x=1,n do v[x] = rand() end
+  end
+  return a
+end
+
+------------------------------------------------------------------------------
+-- FFT: Fast Fourier Transform.
+------------------------------------------------------------------------------
+
+local function fft_bitreverse(v, n)
+  local j = 0
+  for i=0,2*n-4,2 do
+    if i < j then
+      v[i+1], v[i+2], v[j+1], v[j+2] = v[j+1], v[j+2], v[i+1], v[i+2]
+    end
+    local k = n
+    while k <= j do j = j - k; k = k / 2 end
+    j = j + k
+  end
+end
+
+local function fft_transform(v, n, dir)
+  if n <= 1 then return end
+  fft_bitreverse(v, n)
+  local dual = 1
+  repeat
+    local dual2 = 2*dual
+    for i=1,2*n-1,2*dual2 do
+      local j = i+dual2
+      local ir, ii = v[i], v[i+1]
+      local jr, ji = v[j], v[j+1]
+      v[j], v[j+1] = ir - jr, ii - ji
+      v[i], v[i+1] = ir + jr, ii + ji
+    end
+    local theta = dir * pi / dual
+    local s, s2 = sin(theta), 2.0 * sin(theta * 0.5)^2
+    local wr, wi = 1.0, 0.0
+    for a=3,dual2-1,2 do
+      wr, wi = wr - s*wi - s2*wr, wi + s*wr - s2*wi
+      for i=a,a+2*(n-dual2),2*dual2 do
+	local j = i+dual2
+	local jr, ji = v[j], v[j+1]
+	local dr, di = wr*jr - wi*ji, wr*ji + wi*jr
+	local ir, ii = v[i], v[i+1]
+	v[j], v[j+1] = ir - dr, ii - di
+	v[i], v[i+1] = ir + dr, ii + di
+      end
+    end
+    dual = dual2
+  until dual >= n
+end
+
+function benchmarks.FFT(n)
+  local l2n = log(n)/log(2)
+  if l2n % 1 ~= 0 then
+    io.stderr:write("Error: FFT data length is not a power of 2\n")
+    os.exit(1)
+  end
+  local v = random_vector(n*2)
+  return function(cycles)
+    local norm = 1.0 / n
+    for p=1,cycles do
+      fft_transform(v, n, -1)
+      fft_transform(v, n, 1)
+      for i=1,n*2 do v[i] = v[i] * norm end
+    end
+    return ((5*n-2)*l2n + 2*(n+1)) * cycles
+  end
+end
+
+------------------------------------------------------------------------------
+-- SOR: Jacobi Successive Over-Relaxation.
+------------------------------------------------------------------------------
+
+local function sor_run(mat, m, n, cycles, omega)
+  local om4, om1 = omega*0.25, 1.0-omega
+  m = m - 1
+  n = n - 1
+  for i=1,cycles do
+    for y=2,m do
+      local v, vp, vn = mat[y], mat[y-1], mat[y+1]
+      for x=2,n do
+	v[x] = om4*((vp[x]+vn[x])+(v[x-1]+v[x+1])) + om1*v[x]
+      end
+    end
+  end
+end
+
+function benchmarks.SOR(n)
+  local mat = random_matrix(n, n)
+  return function(cycles)
+    sor_run(mat, n, n, cycles, 1.25)
+    return (n-1)*(n-1)*cycles*6
+  end
+end
+
+------------------------------------------------------------------------------
+-- MC: Monte Carlo Integration.
+------------------------------------------------------------------------------
+
+local function mc_integrate(cycles)
+  local under_curve = 0
+  local rand = rand
+  for i=1,cycles do
+    local x = rand()
+    local y = rand()
+    if x*x + y*y <= 1.0 then under_curve = under_curve + 1 end
+  end
+  return (under_curve/cycles) * 4
+end
+
+function benchmarks.MC()
+  return function(cycles)
+    local res = mc_integrate(cycles)
+    assert(math.sqrt(cycles)*math.abs(res-math.pi) < 5.0, "bad MC result")
+    return cycles * 4 -- Way off, but same as SciMark in C/Java.
+  end
+end
+
+------------------------------------------------------------------------------
+-- Sparse Matrix Multiplication.
+------------------------------------------------------------------------------
+
+local function sparse_mult(n, cycles, vy, val, row, col, vx)
+  for p=1,cycles do
+    for r=1,n do
+      local sum = 0
+      for i=row[r],row[r+1]-1 do sum = sum + vx[col[i]] * val[i] end
+      vy[r] = sum
+    end
+  end
+end
+
+function benchmarks.SPARSE(n, nz)
+  local nr = floor(nz/n)
+  local anz = nr*n
+  local vx = random_vector(n)
+  local val = random_vector(anz)
+  local vy, col, row = darray(n+1), iarray(nz+1), iarray(n+2)
+  row[1] = 1
+  for r=1,n do
+    local step = floor(r/nr)
+    if step < 1 then step = 1 end
+    local rr = row[r]
+    row[r+1] = rr+nr
+    for i=0,nr-1 do col[rr+i] = 1+i*step end
+  end
+  return function(cycles)
+    sparse_mult(n, cycles, vy, val, row, col, vx)
+    return anz*cycles*2
+  end
+end
+
+------------------------------------------------------------------------------
+-- LU: Dense Matrix Factorization.
+------------------------------------------------------------------------------
+
+local function lu_factor(a, pivot, m, n)
+  local min_m_n = m < n and m or n
+  for j=1,min_m_n do
+    local jp, t = j, abs(a[j][j])
+    for i=j+1,m do
+      local ab = abs(a[i][j])
+      if ab > t then
+	jp = i
+	t = ab
+      end
+    end
+    pivot[j] = jp
+    if a[jp][j] == 0 then error("zero pivot") end
+    if jp ~= j then a[j], a[jp] = a[jp], a[j] end
+    if j < m then
+      local recp = 1.0 / a[j][j]
+      for k=j+1,m do
+	local v = a[k]
+	v[j] = v[j] * recp
+      end
+    end
+    if j < min_m_n then
+      for i=j+1,m do
+	local vi, vj = a[i], a[j]
+	local eij = vi[j]
+	for k=j+1,n do vi[k] = vi[k] - eij * vj[k] end
+      end
+    end
+  end
+end
+
+local function matrix_alloc(m, n)
+  local a = {}
+  for y=1,m do a[y] = darray(n+1) end
+  return a
+end
+
+local function matrix_copy(dst, src, m, n)
+  for y=1,m do
+    local vd, vs = dst[y], src[y]
+    for x=1,n do vd[x] = vs[x] end
+  end
+end
+
+function benchmarks.LU(n)
+  local mat = random_matrix(n, n)
+  local tmp = matrix_alloc(n, n)
+  local pivot = iarray(n+1)
+  return function(cycles)
+    for i=1,cycles do
+      matrix_copy(tmp, mat, n, n)
+      lu_factor(tmp, pivot, n, n)
+    end
+    return 2.0/3.0*n*n*n*cycles
+  end
+end
+
+------------------------------------------------------------------------------
+-- Main program.
+------------------------------------------------------------------------------
+
+local function printf(...)
+  io.write(format(...))
+end
+
+local function fmtparams(p1, p2)
+  if p2 then return format("[%d, %d]", p1, p2)
+  elseif p1 then return format("[%d]", p1) end
+  return ""
+end
+
+local function measure(min_time, name, ...)
+  array_init()
+  rand_init(RANDOM_SEED)
+  local run = benchmarks[name](...)
+  local cycles = 1
+  repeat
+    local tm = clock()
+    local flops = run(cycles, ...)
+    tm = clock() - tm
+    if tm >= min_time then
+      local res = flops / tm * 1.0e-6
+      local p1, p2 = ...
+      printf("%-7s %8.2f  %s\n", name, res, fmtparams(...))
+      return res
+    end
+    cycles = cycles * 2
+  until false
+end
+
+printf("Lua SciMark %s based on SciMark 2.0a. %s.\n\n",
+       SCIMARK_VERSION, SCIMARK_COPYRIGHT)
+
+while arg and arg[1] do
+  local a = table.remove(arg, 1)
+  if a == "-noffi" then
+    package.preload.ffi = nil
+  elseif a == "-small" then
+    SIZE_SELECT = "small"
+  elseif a == "-large" then
+    SIZE_SELECT = "large"
+  elseif benchmarks[a] then
+    local p = benchmarks[SIZE_SELECT][a]
+    measure(MIN_TIME, a, tonumber(arg[1]) or p[1], tonumber(arg[2]) or p[2])
+    return
+  else
+    printf("Usage: scimark [-noffi] [-small|-large] [BENCH params...]\n\n")
+    printf("BENCH   -small         -large\n")
+    printf("---------------------------------------\n")
+    for _,name in ipairs(benchmarks) do
+      printf("%-7s %-13s %s\n", name,
+	     fmtparams(unpack(benchmarks.small[name])),
+	     fmtparams(unpack(benchmarks.large[name])))
+    end
+    printf("\n")
+    os.exit(1)
+  end
+end
+
+local params = benchmarks[SIZE_SELECT]
+local sum = 0
+for _,name in ipairs(benchmarks) do
+  sum = sum + measure(MIN_TIME, name, unpack(params[name]))
+end
+printf("\nSciMark %8.2f  [%s problem sizes]\n", sum / #benchmarks, SIZE_SELECT)
+io.flush()
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/sieve.lua b/lua_benchmark/tests/Lua-Benchmarks/sieve.lua
new file mode 100644
index 0000000..e2c1487
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/sieve.lua
@@ -0,0 +1,33 @@
+-- $Id: sieve.lua,v 1.9 2001/05/06 04:37:45 doug Exp $

+-- http://www.bagley.org/~doug/shootout/

+--

+-- Roberto Ierusalimschy pointed out the for loop is much

+-- faster for our purposes here than using a while loop.

+

+local count = 0

+

+function main(num, lim)

+    local flags = {}

+    for num=num,1,-1 do

+	count = 0

+	for i=1,lim do

+          flags[i] = 1

+        end

+	for i=2,lim do

+	    if flags[i] == 1 then

+	        k = 0

+	        for k=i+i, lim, i do

+		    flags[k] = 0

+		end

+	        count = count + 1	

+	    end

+	end

+    end

+end

+

+NUM = tonumber((arg and arg[1])) or 100

+lim = (arg and arg[2]) or 8192 

+print(NUM,lim)

+count = 0

+main(NUM, lim)

+print("Count: ", count)

diff --git a/lua_benchmark/tests/Lua-Benchmarks/spectral-norm.lua b/lua_benchmark/tests/Lua-Benchmarks/spectral-norm.lua
new file mode 100644
index 0000000..5ba652f
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/spectral-norm.lua
@@ -0,0 +1,43 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+local function A(i, j)
+  local ij = i+j-1
+  return 1.0 / (ij * (ij-1) * 0.5 + i)
+end
+
+local function Av(x, y, N)
+  for i=1,N do
+    local a = 0
+    for j=1,N do a = a + x[j] * A(i, j) end
+    y[i] = a
+  end
+end
+
+local function Atv(x, y, N)
+  for i=1,N do
+    local a = 0
+    for j=1,N do a = a + x[j] * A(j, i) end
+    y[i] = a
+  end
+end
+
+local function AtAv(x, y, t, N)
+  Av(x, t, N)
+  Atv(t, y, N)
+end
+
+local N = tonumber(arg and arg[1]) or 100
+local u, v, t = {}, {}, {}
+for i=1,N do u[i] = 1 end
+
+for i=1,10 do AtAv(u, v, t, N) AtAv(v, u, t, N) end
+
+local vBv, vv = 0, 0
+for i=1,N do
+  local ui, vi = u[i], v[i]
+  vBv = vBv + ui*vi
+  vv = vv + vi*vi
+end
+io.write(string.format("%0.9f\n", math.sqrt(vBv / vv)))
diff --git a/magic_buddy/magic_buddy.c b/magic_buddy/magic_buddy.c
index 15bd23f..da18d4a 100644
--- a/magic_buddy/magic_buddy.c
+++ b/magic_buddy/magic_buddy.c
@@ -15,10 +15,10 @@ struct free_block {
 // https://stackoverflow.com/questions/11376288/fast-computing-of-log2-for-64-bit-integers
 static size_t size2log(size_t size, int ceil) {
 #if 1
+    if (!size) return 0;
     size_t floor_log
         = (8*sizeof(unsigned long long))
         - __builtin_clzll((unsigned long long)size) - 1;
-    if (!size) floor_log = 0;
     return (ceil && (size > (1 << floor_log))) ? (floor_log + 1) : floor_log;
 #else
     size_t floor_log = 0;