From d068f0b3c11348a50c18af1ee3b0d2e5f38c4faf Mon Sep 17 00:00:00 2001
From: Matthew Sotoudeh <matthew@masot.net>
Date: Fri, 17 May 2024 15:57:30 -0700
Subject: lua benchmarks

---
 lua_benchmark/tests/Lua-Benchmarks/fasta.lua | 106 +++++++++++++++++++++++++++
 1 file changed, 106 insertions(+)
 create mode 100644 lua_benchmark/tests/Lua-Benchmarks/fasta.lua

(limited to 'lua_benchmark/tests/Lua-Benchmarks/fasta.lua')

diff --git a/lua_benchmark/tests/Lua-Benchmarks/fasta.lua b/lua_benchmark/tests/Lua-Benchmarks/fasta.lua
new file mode 100644
index 0000000..3c3fe63
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/fasta.lua
@@ -0,0 +1,106 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+-- Compability with Lua 5.3
+if not loadstring then
+    loadstring = load
+end
+if not unpack then
+    unpack = table.unpack
+end
+
+local Last = 42
+local function random(max)
+  local y = (Last * 3877 + 29573) % 139968
+  Last = y
+  return (max * y) / 139968
+end
+
+local function make_repeat_fasta(id, desc, s, n)
+  local write, sub = io.write, string.sub
+  write(">", id, " ", desc, "\n")
+  local p, sn, s2 = 1, #s, s..s
+  for i=60,n,60 do
+    write(sub(s2, p, p + 59), "\n")
+    p = p + 60; if p > sn then p = p - sn end
+  end
+  local tail = n % 60
+  if tail > 0 then write(sub(s2, p, p + tail-1), "\n") end
+end
+
+local function make_random_fasta(id, desc, bs, n)
+  io.write(">", id, " ", desc, "\n")
+  loadstring([=[
+    local write, char, unpack, n, random = io.write, string.char, unpack, ...
+    local buf, p = {}, 1
+    for i=60,n,60 do
+      for j=p,p+59 do ]=]..bs..[=[ end
+      buf[p+60] = 10; p = p + 61
+      if p >= 2048 then write(char(unpack(buf, 1, p-1))); p = 1 end
+    end
+    local tail = n % 60
+    if tail > 0 then
+      for j=p,p+tail-1 do ]=]..bs..[=[ end
+      p = p + tail; buf[p] = 10; p = p + 1
+    end
+    write(char(unpack(buf, 1, p-1)))
+  ]=], desc)(n, random)
+end
+
+local function bisect(c, p, lo, hi)
+  local n = hi - lo
+  if n == 0 then return "buf[j] = "..c[hi].."\n" end
+  local mid = math.floor(n / 2)
+  return "if r < "..p[lo+mid].." then\n"..bisect(c, p, lo, lo+mid)..
+         "else\n"..bisect(c, p, lo+mid+1, hi).."end\n"
+end
+
+local function make_bisect(tab)
+  local c, p, sum = {}, {}, 0
+  for i,row in ipairs(tab) do
+    c[i] = string.byte(row[1])
+    sum = sum + row[2]
+    p[i] = sum
+  end
+  return "local r = random(1)\n"..bisect(c, p, 1, #tab)
+end
+
+local alu =
+  "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"..
+  "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"..
+  "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"..
+  "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"..
+  "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"..
+  "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"..
+  "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+local iub = make_bisect{
+  { "a", 0.27 },
+  { "c", 0.12 },
+  { "g", 0.12 },
+  { "t", 0.27 },
+  { "B", 0.02 },
+  { "D", 0.02 },
+  { "H", 0.02 },
+  { "K", 0.02 },
+  { "M", 0.02 },
+  { "N", 0.02 },
+  { "R", 0.02 },
+  { "S", 0.02 },
+  { "V", 0.02 },
+  { "W", 0.02 },
+  { "Y", 0.02 },
+}
+
+local homosapiens = make_bisect{
+  { "a", 0.3029549426680 },
+  { "c", 0.1979883004921 },
+  { "g", 0.1975473066391 },
+  { "t", 0.3015094502008 },
+}
+
+local N = tonumber(arg and arg[1]) or 1000
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, N*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, N*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, N*5)
-- 
cgit v1.2.3