summaryrefslogtreecommitdiff
path: root/lua_benchmark
diff options
context:
space:
mode:
Diffstat (limited to 'lua_benchmark')
-rw-r--r--lua_benchmark/Makefile27
-rwxr-xr-xlua_benchmark/benchmark.sh11
l---------lua_benchmark/magic_buddy1
-rw-r--r--lua_benchmark/main.c116
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/.gitignore1
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/LICENSE21
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/ack.lua16
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/binary-trees.lua51
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/fannkuch-redux.lua49
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/fasta.lua106
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/fixpoint-fact.lua24
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/heapsort.lua48
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/k-nucleotide.lua66
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/mandel.lua66
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/n-body.lua121
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/plot.gpi18
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/qt.lua304
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/queen.lua46
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/readme.md31
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/regex-dna.lua59
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.pngbin0 -> 50478 bytes
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.txt14
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.pngbin0 -> 51441 bytes
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.txt14
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53_log.txt69
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5_log.txt43
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.pngbin0 -> 56251 bytes
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.txt14
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit_log.txt43
-rwxr-xr-xlua_benchmark/tests/Lua-Benchmarks/runbenchmarks.lua234
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/scimark.lua433
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/sieve.lua33
-rw-r--r--lua_benchmark/tests/Lua-Benchmarks/spectral-norm.lua43
33 files changed, 2122 insertions, 0 deletions
diff --git a/lua_benchmark/Makefile b/lua_benchmark/Makefile
new file mode 100644
index 0000000..7d73403
--- /dev/null
+++ b/lua_benchmark/Makefile
@@ -0,0 +1,27 @@
+.PHONY: all clean
+
+CFLAGS += -g
+CFLAGS += -O3
+CFLAGS += -llua5.4
+# CFLAGS += -fsanitize=address
+
+all: build/system build/magic_buddy build/jemalloc build/growing_magic_buddy
+
+build/system: main.c
+ @ mkdir -p build
+ $(CC) -DALLOC_SYSTEM $^ $(CFLAGS) -o $@
+
+build/jemalloc: main.c
+ @ mkdir -p build
+ $(CC) -DALLOC_SYSTEM -ljemalloc $^ $(CFLAGS) -o $@
+
+build/magic_buddy: main.c magic_buddy/magic_buddy.c
+ @ mkdir -p build
+ $(CC) -DALLOC_MAGIC_BUDDY $^ $(CFLAGS) -o $@
+
+build/growing_magic_buddy: main.c magic_buddy/magic_buddy.c
+ @ mkdir -p build
+ $(CC) -DALLOC_GROWING_MAGIC_BUDDY $^ $(CFLAGS) -o $@
+
+clean:
+ rm -rf build
diff --git a/lua_benchmark/benchmark.sh b/lua_benchmark/benchmark.sh
new file mode 100755
index 0000000..a7248ea
--- /dev/null
+++ b/lua_benchmark/benchmark.sh
@@ -0,0 +1,11 @@
+#!/bin/bash
+
+set -x
+set -e
+
+make -B
+
+time ./build/system $1
+time ./build/jemalloc $1
+time ./build/magic_buddy $1
+time ./build/growing_magic_buddy $1
diff --git a/lua_benchmark/magic_buddy b/lua_benchmark/magic_buddy
new file mode 120000
index 0000000..2d4a61e
--- /dev/null
+++ b/lua_benchmark/magic_buddy
@@ -0,0 +1 @@
+../magic_buddy \ No newline at end of file
diff --git a/lua_benchmark/main.c b/lua_benchmark/main.c
new file mode 100644
index 0000000..a05c744
--- /dev/null
+++ b/lua_benchmark/main.c
@@ -0,0 +1,116 @@
+#include <stdlib.h>
+#include <stdio.h>
+#include <string.h>
+#include <fcntl.h>
+#include <assert.h>
+#include <unistd.h>
+#include <lua5.4/lua.h>
+#include <lua5.4/lauxlib.h>
+#include <lua5.4/lualib.h>
+
+static void get_random(uint8_t *dst, size_t count) {
+ int fd = open("/dev/urandom", O_RDONLY);
+ assert(count == read(fd, dst, count));
+ close(fd);
+}
+
+#if defined(ALLOC_MAGIC_BUDDY)
+
+#include "magic_buddy/magic_buddy.h"
+const size_t POOL_SIZE = 1024 * 1024 * 1024;
+static struct buddy BUDDY;
+
+static void init_allocator() {
+ uint8_t magic[MAGIC_COOKIE_BYTES];
+ get_random(magic, MAGIC_COOKIE_BYTES);
+
+ uint8_t *pool = malloc(POOL_SIZE);
+ init_buddy(pool, POOL_SIZE, magic, &BUDDY);
+}
+
+static void *allocator_fn(void *ud, void *ptr, size_t osize, size_t nsize) {
+ // https://www.lua.org/manual/5.4/manual.html#4.6
+ if (!ptr) return allocate(nsize, &BUDDY);
+
+ if (nsize == 0) {
+ liberate(ptr, osize, &BUDDY);
+ return NULL;
+ }
+
+ return reallocate(ptr, nsize, osize, &BUDDY);
+}
+
+#elif defined(ALLOC_GROWING_MAGIC_BUDDY)
+
+#include "magic_buddy/magic_buddy.h"
+static size_t POOL_SIZE;
+static void *POOL;
+static struct buddy BUDDY;
+
+static void init_allocator() {
+ uint8_t magic[MAGIC_COOKIE_BYTES];
+ get_random(magic, MAGIC_COOKIE_BYTES);
+
+ POOL_SIZE = 1024;
+ POOL = sbrk(POOL_SIZE);
+ assert(POOL != (void *)-1);
+ init_buddy(POOL, POOL_SIZE, magic, &BUDDY);
+}
+
+static int grow_pool() {
+ if (sbrk(POOL_SIZE) == (void *)-1) return 0;
+ POOL_SIZE *= 2;
+ grow_buddy(POOL, POOL_SIZE, &BUDDY);
+ return 1;
+}
+
+static void *allocator_fn(void *ud, void *ptr, size_t osize, size_t nsize) {
+ // https://www.lua.org/manual/5.4/manual.html#4.6
+ void *result = 0;
+ if (!ptr) {
+ while (!(result = allocate(nsize, &BUDDY)))
+ if (!grow_pool()) return 0;
+ return result;
+ }
+
+ if (nsize == 0) {
+ liberate(ptr, osize, &BUDDY);
+ return NULL;
+ }
+
+ while (!(result = reallocate(ptr, nsize, osize, &BUDDY)))
+ if (!grow_pool()) return 0;
+ return result;
+}
+
+#elif defined(ALLOC_SYSTEM)
+
+static void init_allocator() { }
+
+static void *allocator_fn(void *ud, void *ptr, size_t osize, size_t nsize) {
+ // https://www.lua.org/manual/5.4/manual.html#4.6
+ if (nsize == 0) {
+ free(ptr);
+ return NULL;
+ }
+ return realloc(ptr, nsize);
+}
+
+#else
+#error "No allocator chosen!"
+#endif
+
+int main(int argc, char **argv) {
+ init_allocator();
+
+ // https://www.lua.org/pil/24.1.html
+ char buff[256];
+ int error;
+ lua_State *L = lua_newstate(allocator_fn, 0); /* opens Lua */
+ luaL_openlibs(L);
+
+ assert(argc == 2);
+ luaL_dofile(L, argv[1]);
+ lua_close(L);
+ return 0;
+}
diff --git a/lua_benchmark/tests/Lua-Benchmarks/.gitignore b/lua_benchmark/tests/Lua-Benchmarks/.gitignore
new file mode 100644
index 0000000..4558236
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/.gitignore
@@ -0,0 +1 @@
+results.*
diff --git a/lua_benchmark/tests/Lua-Benchmarks/LICENSE b/lua_benchmark/tests/Lua-Benchmarks/LICENSE
new file mode 100644
index 0000000..71c4e2e
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/LICENSE
@@ -0,0 +1,21 @@
+MIT License
+
+Copyright (c) 2017 Gabriel de Quadros Ligneul
+
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+
+The above copyright notice and this permission notice shall be included in all
+copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+SOFTWARE.
diff --git a/lua_benchmark/tests/Lua-Benchmarks/ack.lua b/lua_benchmark/tests/Lua-Benchmarks/ack.lua
new file mode 100644
index 0000000..3b41935
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/ack.lua
@@ -0,0 +1,16 @@
+-- $Id: ackermann.lua,v 1.5 2000/12/09 20:07:43 doug Exp $
+-- http://www.bagley.org/~doug/shootout/
+
+local function Ack(M, N)
+ if (M == 0) then
+ return N + 1
+ end
+ if (N == 0) then
+ return Ack(M - 1, 1)
+ end
+ return Ack(M - 1, Ack(M, (N - 1)))
+end
+
+N = tonumber((arg and arg[1])) or 3
+M = tonumber((arg and arg[2])) or 8
+print(string.format("Ack(%d, %d) = %d\n", N, M, Ack(N,M)))
diff --git a/lua_benchmark/tests/Lua-Benchmarks/binary-trees.lua b/lua_benchmark/tests/Lua-Benchmarks/binary-trees.lua
new file mode 100644
index 0000000..d7f52e3
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/binary-trees.lua
@@ -0,0 +1,51 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+local function BottomUpTree(item, depth)
+ if depth > 0 then
+ local i = item + item
+ depth = depth - 1
+ local left, right = BottomUpTree(i-1, depth), BottomUpTree(i, depth)
+ return { item, left, right }
+ else
+ return { item }
+ end
+end
+
+local function ItemCheck(tree)
+ if tree[2] then
+ return tree[1] + ItemCheck(tree[2]) - ItemCheck(tree[3])
+ else
+ return tree[1]
+ end
+end
+
+-- local N = tonumber(arg and arg[1]) or 0
+local N = 15
+local mindepth = 4
+local maxdepth = mindepth + 2
+if maxdepth < N then maxdepth = N end
+
+do
+ local stretchdepth = maxdepth + 1
+ local stretchtree = BottomUpTree(0, stretchdepth)
+ io.write(string.format("stretch tree of depth %d\t check: %d\n",
+ stretchdepth, ItemCheck(stretchtree)))
+end
+
+local longlivedtree = BottomUpTree(0, maxdepth)
+
+for depth=mindepth,maxdepth,2 do
+ local iterations = 2 ^ (maxdepth - depth + mindepth)
+ local check = 0
+ for i=1,iterations do
+ check = check + ItemCheck(BottomUpTree(1, depth)) +
+ ItemCheck(BottomUpTree(-1, depth))
+ end
+ io.write(string.format("%d\t trees of depth %d\t check: %d\n",
+ iterations*2, depth, check))
+end
+
+io.write(string.format("long lived tree of depth %d\t check: %d\n",
+ maxdepth, ItemCheck(longlivedtree)))
diff --git a/lua_benchmark/tests/Lua-Benchmarks/fannkuch-redux.lua b/lua_benchmark/tests/Lua-Benchmarks/fannkuch-redux.lua
new file mode 100644
index 0000000..51f5fc6
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/fannkuch-redux.lua
@@ -0,0 +1,49 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+local function fannkuch(n)
+ local p, q, s, sign, maxflips, sum = {}, {}, {}, 1, 0, 0
+ for i=1,n do p[i] = i; q[i] = i; s[i] = i end
+ repeat
+ -- Copy and flip.
+ local q1 = p[1] -- Cache 1st element.
+ if q1 ~= 1 then
+ for i=2,n do q[i] = p[i] end -- Work on a copy.
+ local flips = 1
+ repeat
+ local qq = q[q1]
+ if qq == 1 then -- ... until 1st element is 1.
+ sum = sum + sign*flips
+ if flips > maxflips then maxflips = flips end -- New maximum?
+ break
+ end
+ q[q1] = q1
+ if q1 >= 4 then
+ local i, j = 2, q1 - 1
+ repeat q[i], q[j] = q[j], q[i]; i = i + 1; j = j - 1; until i >= j
+ end
+ q1 = qq; flips = flips + 1
+ until false
+ end
+ -- Permute.
+ if sign == 1 then
+ p[2], p[1] = p[1], p[2]; sign = -1 -- Rotate 1<-2.
+ else
+ p[2], p[3] = p[3], p[2]; sign = 1 -- Rotate 1<-2 and 1<-2<-3.
+ for i=3,n do
+ local sx = s[i]
+ if sx ~= 1 then s[i] = sx-1; break end
+ if i == n then return sum, maxflips end -- Out of permutations.
+ s[i] = i
+ -- Rotate 1<-...<-i+1.
+ local t = p[1]; for j=1,i do p[j] = p[j+1] end; p[i+1] = t
+ end
+ end
+ until false
+end
+
+-- local n = tonumber(arg and arg[1]) or 7
+local n = 10
+local sum, flips = fannkuch(n)
+io.write(sum, "\nPfannkuchen(", n, ") = ", flips, "\n")
diff --git a/lua_benchmark/tests/Lua-Benchmarks/fasta.lua b/lua_benchmark/tests/Lua-Benchmarks/fasta.lua
new file mode 100644
index 0000000..3c3fe63
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/fasta.lua
@@ -0,0 +1,106 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+-- Compability with Lua 5.3
+if not loadstring then
+ loadstring = load
+end
+if not unpack then
+ unpack = table.unpack
+end
+
+local Last = 42
+local function random(max)
+ local y = (Last * 3877 + 29573) % 139968
+ Last = y
+ return (max * y) / 139968
+end
+
+local function make_repeat_fasta(id, desc, s, n)
+ local write, sub = io.write, string.sub
+ write(">", id, " ", desc, "\n")
+ local p, sn, s2 = 1, #s, s..s
+ for i=60,n,60 do
+ write(sub(s2, p, p + 59), "\n")
+ p = p + 60; if p > sn then p = p - sn end
+ end
+ local tail = n % 60
+ if tail > 0 then write(sub(s2, p, p + tail-1), "\n") end
+end
+
+local function make_random_fasta(id, desc, bs, n)
+ io.write(">", id, " ", desc, "\n")
+ loadstring([=[
+ local write, char, unpack, n, random = io.write, string.char, unpack, ...
+ local buf, p = {}, 1
+ for i=60,n,60 do
+ for j=p,p+59 do ]=]..bs..[=[ end
+ buf[p+60] = 10; p = p + 61
+ if p >= 2048 then write(char(unpack(buf, 1, p-1))); p = 1 end
+ end
+ local tail = n % 60
+ if tail > 0 then
+ for j=p,p+tail-1 do ]=]..bs..[=[ end
+ p = p + tail; buf[p] = 10; p = p + 1
+ end
+ write(char(unpack(buf, 1, p-1)))
+ ]=], desc)(n, random)
+end
+
+local function bisect(c, p, lo, hi)
+ local n = hi - lo
+ if n == 0 then return "buf[j] = "..c[hi].."\n" end
+ local mid = math.floor(n / 2)
+ return "if r < "..p[lo+mid].." then\n"..bisect(c, p, lo, lo+mid)..
+ "else\n"..bisect(c, p, lo+mid+1, hi).."end\n"
+end
+
+local function make_bisect(tab)
+ local c, p, sum = {}, {}, 0
+ for i,row in ipairs(tab) do
+ c[i] = string.byte(row[1])
+ sum = sum + row[2]
+ p[i] = sum
+ end
+ return "local r = random(1)\n"..bisect(c, p, 1, #tab)
+end
+
+local alu =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"..
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"..
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"..
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"..
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"..
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"..
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
+
+local iub = make_bisect{
+ { "a", 0.27 },
+ { "c", 0.12 },
+ { "g", 0.12 },
+ { "t", 0.27 },
+ { "B", 0.02 },
+ { "D", 0.02 },
+ { "H", 0.02 },
+ { "K", 0.02 },
+ { "M", 0.02 },
+ { "N", 0.02 },
+ { "R", 0.02 },
+ { "S", 0.02 },
+ { "V", 0.02 },
+ { "W", 0.02 },
+ { "Y", 0.02 },
+}
+
+local homosapiens = make_bisect{
+ { "a", 0.3029549426680 },
+ { "c", 0.1979883004921 },
+ { "g", 0.1975473066391 },
+ { "t", 0.3015094502008 },
+}
+
+local N = tonumber(arg and arg[1]) or 1000
+make_repeat_fasta('ONE', 'Homo sapiens alu', alu, N*2)
+make_random_fasta('TWO', 'IUB ambiguity codes', iub, N*3)
+make_random_fasta('THREE', 'Homo sapiens frequency', homosapiens, N*5)
diff --git a/lua_benchmark/tests/Lua-Benchmarks/fixpoint-fact.lua b/lua_benchmark/tests/Lua-Benchmarks/fixpoint-fact.lua
new file mode 100644
index 0000000..743a67c
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/fixpoint-fact.lua
@@ -0,0 +1,24 @@
+-- fixed-point operator
+local Z = function (le)
+ local a = function (f)
+ return le(function (x) return f(f)(x) end)
+ end
+ return a(a)
+ end
+
+
+-- non-recursive factorial
+
+local F = function (f)
+ return function (n)
+ if n == 0 then return 1
+ else return n*f(n-1) end
+ end
+ end
+
+local fat = Z(F)
+
+local s = 0
+for i = 1, arg[1] or 100 do s = s + fat(i) end
+print(s)
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/heapsort.lua b/lua_benchmark/tests/Lua-Benchmarks/heapsort.lua
new file mode 100644
index 0000000..0aaf7cb
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/heapsort.lua
@@ -0,0 +1,48 @@
+local random, floor = math.random, math.floor
+floor = math.ifloor or floor
+
+function heapsort(n, ra)
+ local j, i, rra
+ local l = floor(n/2) + 1
+ -- local l = (n//2) + 1
+ local ir = n;
+ while 1 do
+ if l > 1 then
+ l = l - 1
+ rra = ra[l]
+ else
+ rra = ra[ir]
+ ra[ir] = ra[1]
+ ir = ir - 1
+ if (ir == 1) then
+ ra[1] = rra
+ return
+ end
+ end
+ i = l
+ j = l * 2
+ while j <= ir do
+ if (j < ir) and (ra[j] < ra[j+1]) then
+ j = j + 1
+ end
+ if rra < ra[j] then
+ ra[i] = ra[j]
+ i = j
+ j = j + i
+ else
+ j = ir + 1
+ end
+ end
+ ra[i] = rra
+ end
+end
+
+local Num = tonumber((arg and arg[1])) or 4
+for i=1,Num do
+ local N = tonumber((arg and arg[2])) or 10000
+ local a = {}
+ for i=1,N do a[i] = random() end
+ heapsort(N, a)
+ for i=1,N-1 do assert(a[i] <= a[i+1]) end
+end
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/k-nucleotide.lua b/lua_benchmark/tests/Lua-Benchmarks/k-nucleotide.lua
new file mode 100644
index 0000000..5deb58d
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/k-nucleotide.lua
@@ -0,0 +1,66 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+local function kfrequency(seq, freq, k, frame)
+ local sub = string.sub
+ local k1 = k - 1
+ for i=frame,string.len(seq)-k1,k do
+ local c = sub(seq, i, i+k1)
+ freq[c] = freq[c] + 1
+ end
+end
+
+local function freqdefault()
+ return 0
+end
+
+local function count(seq, frag)
+ local k = string.len(frag)
+ local freq = setmetatable({}, { __index = freqdefault })
+ for frame=1,k do kfrequency(seq, freq, k, frame) end
+ io.write(freq[frag] or 0, "\t", frag, "\n")
+end
+
+local function frequency(seq, k)
+ local freq = setmetatable({}, { __index = freqdefault })
+ for frame=1,k do kfrequency(seq, freq, k, frame) end
+ local sfreq, sn = {}, 1
+ for c,v in pairs(freq) do sfreq[sn] = c; sn = sn + 1 end
+ table.sort(sfreq, function(a, b)
+ local fa, fb = freq[a], freq[b]
+ return fa == fb and a > b or fa > fb
+ end)
+ sum = string.len(seq)-k+1
+ for _,c in ipairs(sfreq) do
+ io.write(string.format("%s %0.3f\n", c, (freq[c]*100)/sum))
+ end
+ io.write("\n")
+end
+
+local function readseq()
+ local sub = string.sub
+ for line in io.lines() do
+ if sub(line, 1, 1) == ">" and sub(line, 2, 6) == "THREE" then break end
+ end
+ local lines, ln = {}, 0
+ for line in io.lines() do
+ local c = sub(line, 1, 1)
+ if c == ">" then
+ break
+ elseif c ~= ";" then
+ ln = ln + 1
+ lines[ln] = line
+ end
+ end
+ return string.upper(table.concat(lines, "", 1, ln))
+end
+
+local seq = readseq()
+frequency(seq, 1)
+frequency(seq, 2)
+count(seq, "GGT")
+count(seq, "GGTA")
+count(seq, "GGTATT")
+count(seq, "GGTATTTTAATT")
+count(seq, "GGTATTTTAATTTATAGT")
diff --git a/lua_benchmark/tests/Lua-Benchmarks/mandel.lua b/lua_benchmark/tests/Lua-Benchmarks/mandel.lua
new file mode 100644
index 0000000..bd080da
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/mandel.lua
@@ -0,0 +1,66 @@
+local Complex={type="package"}
+
+local function complex(x,y)
+ return setmetatable({ re=x, im=y }, Complex.metatable)
+end
+
+function Complex.conj(x,y)
+ return complex(x.re,-x.im)
+end
+
+function Complex.norm2(x)
+ local n=Complex.mul(x,Complex.conj(x))
+ return n.re
+end
+
+function Complex.abs(x)
+ return sqrt(Complex.norm2(x))
+end
+
+function Complex.add(x,y)
+ return complex(x.re+y.re,x.im+y.im)
+end
+
+function Complex.mul(x,y)
+ return complex(x.re*y.re-x.im*y.im,x.re*y.im+x.im*y.re)
+end
+
+Complex.metatable={
+ __add = Complex.add,
+ __mul = Complex.mul,
+}
+
+local function abs(x)
+ return math.sqrt(Complex.norm2(x))
+end
+
+xmin=-2.0 xmax=2.0 ymin=-2.0 ymax=2.0
+N=arg[1] or 256
+
+function level(x,y)
+ local c=complex(x,y)
+ local l=0
+ local z=c
+ repeat
+ z=z*z+c
+ l=l+1
+ until abs(z)>2.0 or l>255
+ return l-1
+end
+
+dx=(xmax-xmin)/N
+dy=(ymax-ymin)/N
+
+print("P2")
+print("# mandelbrot set",xmin,xmax,ymin,ymax,N)
+print(N,N,255)
+local S = 0
+for i=1,N do
+ local x=xmin+(i-1)*dx
+ for j=1,N do
+ local y=ymin+(j-1)*dy
+ S = S + level(x,y)
+ end
+ -- if i % 10 == 0 then print(collectgarbage"count") end
+end
+print(S)
diff --git a/lua_benchmark/tests/Lua-Benchmarks/n-body.lua b/lua_benchmark/tests/Lua-Benchmarks/n-body.lua
new file mode 100644
index 0000000..40cee46
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/n-body.lua
@@ -0,0 +1,121 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+-- modified by Geoff Leyland
+-- modified by Mario Pernici
+
+sun = {}
+jupiter = {}
+saturn = {}
+uranus = {}
+neptune = {}
+
+local sqrt = math.sqrt
+
+local PI = 3.141592653589793
+local SOLAR_MASS = 4 * PI * PI
+local DAYS_PER_YEAR = 365.24
+sun.x = 0.0
+sun.y = 0.0
+sun.z = 0.0
+sun.vx = 0.0
+sun.vy = 0.0
+sun.vz = 0.0
+sun.mass = SOLAR_MASS
+jupiter.x = 4.84143144246472090e+00
+jupiter.y = -1.16032004402742839e+00
+jupiter.z = -1.03622044471123109e-01
+jupiter.vx = 1.66007664274403694e-03 * DAYS_PER_YEAR
+jupiter.vy = 7.69901118419740425e-03 * DAYS_PER_YEAR
+jupiter.vz = -6.90460016972063023e-05 * DAYS_PER_YEAR
+jupiter.mass = 9.54791938424326609e-04 * SOLAR_MASS
+saturn.x = 8.34336671824457987e+00
+saturn.y = 4.12479856412430479e+00
+saturn.z = -4.03523417114321381e-01
+saturn.vx = -2.76742510726862411e-03 * DAYS_PER_YEAR
+saturn.vy = 4.99852801234917238e-03 * DAYS_PER_YEAR
+saturn.vz = 2.30417297573763929e-05 * DAYS_PER_YEAR
+saturn.mass = 2.85885980666130812e-04 * SOLAR_MASS
+uranus.x = 1.28943695621391310e+01
+uranus.y = -1.51111514016986312e+01
+uranus.z = -2.23307578892655734e-01
+uranus.vx = 2.96460137564761618e-03 * DAYS_PER_YEAR
+uranus.vy = 2.37847173959480950e-03 * DAYS_PER_YEAR
+uranus.vz = -2.96589568540237556e-05 * DAYS_PER_YEAR
+uranus.mass = 4.36624404335156298e-05 * SOLAR_MASS
+neptune.x = 1.53796971148509165e+01
+neptune.y = -2.59193146099879641e+01
+neptune.z = 1.79258772950371181e-01
+neptune.vx = 2.68067772490389322e-03 * DAYS_PER_YEAR
+neptune.vy = 1.62824170038242295e-03 * DAYS_PER_YEAR
+neptune.vz = -9.51592254519715870e-05 * DAYS_PER_YEAR
+neptune.mass = 5.15138902046611451e-05 * SOLAR_MASS
+
+local bodies = {sun,jupiter,saturn,uranus,neptune}
+
+local function advance(bodies, nbody, dt)
+ for i=1,nbody do
+ local bi = bodies[i]
+ local bix, biy, biz, bimass = bi.x, bi.y, bi.z, bi.mass
+ local bivx, bivy, bivz = bi.vx, bi.vy, bi.vz
+ for j=i+1,nbody do
+ local bj = bodies[j]
+ local dx, dy, dz = bix-bj.x, biy-bj.y, biz-bj.z
+ local dist2 = dx*dx + dy*dy + dz*dz
+ local mag = sqrt(dist2)
+ mag = dt / (mag * dist2)
+ local bm = bj.mass*mag
+ bivx = bivx - (dx * bm)
+ bivy = bivy - (dy * bm)
+ bivz = bivz - (dz * bm)
+ bm = bimass*mag
+ bj.vx = bj.vx + (dx * bm)
+ bj.vy = bj.vy + (dy * bm)
+ bj.vz = bj.vz + (dz * bm)
+ end
+ bi.vx = bivx
+ bi.vy = bivy
+ bi.vz = bivz
+ bi.x = bix + dt * bivx
+ bi.y = biy + dt * bivy
+ bi.z = biz + dt * bivz
+ end
+end
+
+local function energy(bodies, nbody)
+ local e = 0
+ for i=1,nbody do
+ local bi = bodies[i]
+ local vx, vy, vz, bim = bi.vx, bi.vy, bi.vz, bi.mass
+ e = e + (0.5 * bim * (vx*vx + vy*vy + vz*vz))
+ for j=i+1,nbody do
+ local bj = bodies[j]
+ local dx, dy, dz = bi.x-bj.x, bi.y-bj.y, bi.z-bj.z
+ local distance = sqrt(dx*dx + dy*dy + dz*dz)
+ e = e - ((bim * bj.mass) / distance)
+ end
+ end
+ return e
+end
+
+local function offsetMomentum(b, nbody)
+ local px, py, pz = 0, 0, 0
+ for i=1,nbody do
+ local bi = b[i]
+ local bim = bi.mass
+ px = px + (bi.vx * bim)
+ py = py + (bi.vy * bim)
+ pz = pz + (bi.vz * bim)
+ end
+ b[1].vx = -px / SOLAR_MASS
+ b[1].vy = -py / SOLAR_MASS
+ b[1].vz = -pz / SOLAR_MASS
+end
+
+local N = tonumber(arg and arg[1]) or 1000
+local nbody = #bodies
+
+offsetMomentum(bodies, nbody)
+io.write( string.format("%0.9f",energy(bodies, nbody)), "\n")
+for i=1,N do advance(bodies, nbody, 0.01) end
+io.write( string.format("%0.9f",energy(bodies, nbody)), "\n")
diff --git a/lua_benchmark/tests/Lua-Benchmarks/plot.gpi b/lua_benchmark/tests/Lua-Benchmarks/plot.gpi
new file mode 100644
index 0000000..24277f4
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/plot.gpi
@@ -0,0 +1,18 @@
+set encoding utf8
+set terminal png size 3000,1000 font 'Helvetica,22'
+set output outfile
+
+set style data histogram
+set style histogram cluster gap 1
+set style fill solid border -1
+set xtic font "Helvetica,14"
+set boxwidth 0.9
+set grid
+set key bmargin center horizontal Left reverse noenhanced autotitle columnhead nobox
+set ylabel ylabel
+
+plot for[i=2:1 + nbinaries] datafile \
+ using i:xtic(1) \
+ title column \
+ ls i
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/qt.lua b/lua_benchmark/tests/Lua-Benchmarks/qt.lua
new file mode 100644
index 0000000..f1de543
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/qt.lua
@@ -0,0 +1,304 @@
+-- qt.lua,15 (one edge vector)
+-- Julia sets via interval cell-mapping (quadtree version)
+
+--require"julia" local f=f
+
+local io=io
+local root,exterior
+local cx,cy
+local Rxmin,Rxmax,Rymin,Rymax=-2.0,2.0,-2.0,2.0
+local white=1.0
+local black=0.0
+local gray=0.5
+local N=0
+local nE=0
+local E={}
+local write=io.write
+
+local function output(a1,a2,a3,a4,a5,a6)
+ write(
+ a1 or ""," ",
+ a2 or ""," ",
+ a3 or ""," ",
+ a4 or ""," ",
+ a5 or ""," ",
+ a6 or ""," \n")
+end
+
+local function imul(xmin,xmax,ymin,ymax)
+ local mm=xmin*ymin
+ local mM=xmin*ymax
+ local Mm=xmax*ymin
+ local MM=xmax*ymax
+ local m,M=mm,mm
+ if m>mM then m=mM elseif M<mM then M=mM end
+ if m>Mm then m=Mm elseif M<Mm then M=Mm end
+ if m>MM then m=MM elseif M<MM then M=MM end
+ return m,M
+end
+
+local function isqr(xmin,xmax)
+ local u=xmin*xmin
+ local v=xmax*xmax
+ if xmin<=0.0 and 0.0<=xmax then
+ if u<v then return 0.0,v else return 0.0,u end
+ else
+ if u<v then return u,v else return v,u end
+ end
+end
+
+local function f(xmin,xmax,ymin,ymax)
+ local x2min,x2max=isqr(xmin,xmax)
+ local y2min,y2max=isqr(ymin,ymax)
+ local xymin,xymax=imul(xmin,xmax,ymin,ymax)
+ return x2min-y2max+cx,x2max-y2min+cx,2.0*xymin+cy,2.0*xymax+cy
+end
+
+local function outside(xmin,xmax,ymin,ymax)
+ local x,y
+ if 0.0<xmin then x=xmin elseif 0.0<xmax then x=0.0 else x=xmax end
+ if 0.0<ymin then y=ymin elseif 0.0<ymax then y=0.0 else y=ymax end
+ return x^2+y^2>4.0
+end
+
+local function inside(xmin,xmax,ymin,ymax)
+ return xmin^2+ymin^2<=4.0 and xmin^2+ymax^2<=4.0 and
+ xmax^2+ymin^2<=4.0 and xmax^2+ymax^2<=4.0
+end
+
+local function newcell()
+ return {nil,nil,nil,nil,color=gray}
+end
+
+local function addedge(a,b)
+ nE=nE+1
+ E[nE]=b
+end
+
+local function refine(q)
+ if q.color==gray then
+ if q[1]==nil then
+ q[1]=newcell()
+ q[2]=newcell()
+ q[3]=newcell()
+ q[4]=newcell()
+ else
+ refine(q[1])
+ refine(q[2])
+ refine(q[3])
+ refine(q[4])
+ end
+ end
+end
+
+local function clip(q,xmin,xmax,ymin,ymax,o,oxmin,oxmax,oymin,oymax)
+ local ixmin,ixmax,iymin,iymax
+ if xmin>oxmin then ixmin=xmin else ixmin=oxmin end
+ if xmax<oxmax then ixmax=xmax else ixmax=oxmax end
+ if ixmin>=ixmax then return end
+ if ymin>oymin then iymin=ymin else iymin=oymin end
+ if ymax<oymax then iymax=ymax else iymax=oymax end
+ --if ixmin<=ixmax and iymin<=iymax then
+ if iymin<iymax then
+ if q[1]==nil then
+ addedge(o,q)
+ else
+ local xmid=(xmin+xmax)/2.0
+ local ymid=(ymin+ymax)/2.0
+ clip(q[1],xmin,xmid,ymid,ymax,o,oxmin,oxmax,oymin,oymax)
+ clip(q[2],xmid,xmax,ymid,ymax,o,oxmin,oxmax,oymin,oymax)
+ clip(q[3],xmin,xmid,ymin,ymid,o,oxmin,oxmax,oymin,oymax)
+ clip(q[4],xmid,xmax,ymin,ymid,o,oxmin,oxmax,oymin,oymax)
+ end
+ end
+end
+
+local function map(q,xmin,xmax,ymin,ymax)
+ --xmin,xmax,ymin,ymax=f(xmin,xmax,ymin,ymax,cx,cy)
+ xmin,xmax,ymin,ymax=f(xmin,xmax,ymin,ymax)
+ if outside(xmin,xmax,ymin,ymax) then
+ q.color=white
+ else
+ if not inside(xmin,xmax,ymin,ymax) then addedge(q,exterior) end
+ clip(root,Rxmin,Rxmax,Rymin,Rymax,q,xmin,xmax,ymin,ymax)
+ end
+end
+
+local function update(q,xmin,xmax,ymin,ymax)
+ if q.color==gray then
+ if q[1]==nil then
+ local b=nE
+ q[2]=nE+1
+ map(q,xmin,xmax,ymin,ymax)
+ q[3]=nE
+ else
+ local xmid=(xmin+xmax)/2.0
+ local ymid=(ymin+ymax)/2.0
+ update(q[1],xmin,xmid,ymid,ymax)
+ update(q[2],xmid,xmax,ymid,ymax)
+ update(q[3],xmin,xmid,ymin,ymid)
+ update(q[4],xmid,xmax,ymin,ymid)
+ end
+ end
+end
+
+local function color(q)
+ if q.color==gray then
+ if q[1]==nil then
+ for i=q[2],q[3] do
+ if E[i].color~=white then return end
+ end
+ q.color=white N=N+1
+ else
+ color(q[1])
+ color(q[2])
+ color(q[3])
+ color(q[4])
+ end
+ end
+end
+
+local function prewhite(q)
+ if q.color==gray then
+ if q[1]==nil then
+ for i=q[2],q[3] do
+ local c=E[i].color
+ if c==white or c==-gray then
+ q.color=-gray
+ N=N+1
+ return
+ end
+ end
+ else
+ prewhite(q[1])
+ prewhite(q[2])
+ prewhite(q[3])
+ prewhite(q[4])
+ end
+ end
+end
+
+local function recolor(q)
+ if q.color==-gray then
+ q.color=gray
+ elseif q.color==gray then
+ if q[1]==nil then
+ q.color=black
+ else
+ recolor(q[1])
+ recolor(q[2])
+ recolor(q[3])
+ recolor(q[4])
+ end
+ end
+end
+
+local function area(q)
+ if q[1]==nil then
+ if q.color==white then return 0.0,0.0
+ elseif q.color==black then return 0.0,1.0
+ else return 1.0,0.0 end
+ else
+ local g1,b1=area(q[1])
+ local g2,b2=area(q[2])
+ local g3,b3=area(q[3])
+ local g4,b4=area(q[4])
+ return (g1+g2+g3+g4)/4.0, (b1+b2+b3+b4)/4.0
+ end
+end
+
+local function colorup(q)
+ if q[1]~=nil and q.color==gray then
+ local c1=colorup(q[1])
+ local c2=colorup(q[2])
+ local c3=colorup(q[3])
+ local c4=colorup(q[4])
+ if c1==c2 and c1==c3 and c1==c4 then
+if c1~=gray then
+ q[1]=nil; --q[2]=nil; q[3]=nil; q[4]=nil
+N=N+1 end
+ q.color=c1
+ end
+ end
+ return q.color
+end
+
+local function save(q,xmin,ymin,N)
+ if q[1]==nil or N==1 then
+ output(xmin,ymin,N,q.color)
+ else
+ N=N/2
+ local xmid=xmin+N
+ local ymid=ymin+N
+ save(q[1],xmin,ymin,N)
+ save(q[2],xmid,ymin,N)
+ save(q[3],xmin,ymid,N)
+ save(q[4],xmid,ymid,N)
+ end
+end
+local function show(p)
+ local N=2^10
+ -- io.output(p..".box")
+ output(N)
+ save(root,0,0,N)
+ -- io.close()
+end
+
+local t0=0
+local function memory(s)
+ local t=os.clock()
+ --local dt=string.format("%f",t-t0)
+ local dt=t-t0
+ io.stdout:write(s,"\t",dt," sec\t",t," sec\t",math.floor(collectgarbage"count"/1024),"M\n")
+ t0=t
+end
+
+local function do_(f,s)
+ local a,b=f(root,Rxmin,Rxmax,Rymin,Rymax)
+ memory(s)
+ return a,b
+end
+
+local function julia(l,a,b)
+memory"begin"
+ cx=a cy=b
+ root=newcell()
+ exterior=newcell() exterior.color=white
+ show(0)
+ for i=1,l do print("\nstep",i)
+ nE=0
+ do_(refine,"refine")
+ do_(update,"update")
+ repeat
+ N=0 color(root,Rxmin,Rxmax,Rymin,Rymax) print("color",N)
+ until N==0 memory"color"
+ repeat
+ N=0 prewhite(root,Rxmin,Rxmax,Rymin,Rymax) print("prewhite",N)
+ until N==0 memory"prewhite"
+ do_(recolor,"recolor")
+ do_(colorup,"colorup") print("colorup",N)
+ local g,b=do_(area,"area") print("area",g,b,g+b)
+ show(i) memory"output"
+ print("edges",nE)
+ end
+end
+
+--julia(14,0.25,0.35)
+--julia(14, -.12, .74 )
+--julia(14,0,0)
+--julia(12,0.25,0)
+--julia(9,0.24,0)
+--julia(9,0.26,0)
+--julia(13,0,1)
+--julia(12,-1.1,0)
+--julia(9,-0.12,0.5)
+
+-- figures for paper
+--julia(14,0,1)
+--julia(14,-1,0)
+--julia(12,-0.12, 0.64)
+--julia(14,-0.12, 0.60)
+--julia(14,-0.12, 0.30)
+
+-- julia (level, a, b) -- julia set de c= a + b i
+julia(10,-0.25, 0.74)
diff --git a/lua_benchmark/tests/Lua-Benchmarks/queen.lua b/lua_benchmark/tests/Lua-Benchmarks/queen.lua
new file mode 100644
index 0000000..9071406
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/queen.lua
@@ -0,0 +1,46 @@
+local N = tonumber(arg[1] or 8) -- board size
+
+
+-- check whether position (n,c) is free from attacks
+local function isplaceok (a, n, c)
+ for i = 1, n - 1 do -- for each queen already placed
+ if (a[i] == c) or -- same column?
+ (a[i] - i == c - n) or -- same diagonal?
+ (a[i] + i == c + n) then -- same diagonal?
+ return false -- place can be attacked
+ end
+ end
+ return true -- no attacks; place is OK
+end
+
+
+-- print a board
+local function printsolution (a)
+ for i = 1, N do
+ for j = 1, N do
+ io.write(a[i] == j and "X" or "-", " ")
+ end
+ io.write("\n")
+ end
+ io.write("\n")
+end
+
+
+-- add to board 'a' all queens from 'n' to 'N'
+local function addqueen (a, n)
+ if n > N then -- all queens have been placed?
+ printsolution(a)
+ else -- try to place n-th queen
+ for c = 1, N do
+ if isplaceok(a, n, c) then
+ a[n] = c -- place n-th queen at column 'c'
+ addqueen(a, n + 1)
+ end
+ end
+ end
+end
+
+
+-- run the program
+addqueen({}, 1)
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/readme.md b/lua_benchmark/tests/Lua-Benchmarks/readme.md
new file mode 100644
index 0000000..b1b6624
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/readme.md
@@ -0,0 +1,31 @@
+# Lua Benchmarks
+
+Compare the performance of different Lua implementations
+
+## Sample Results
+
+Computer information:
+
+```
+Distro: CentOS release 6.8 (Final)
+Kernel: 2.6.32-642.13.1.el6.x86_64
+CPU: Intel(R) Core(TM) i7-4770 CPU @ 3.40GHz
+```
+![](https://raw.githubusercontent.com/gligneul/Lua-Benchmarks/master/results/speedup_luajit.png)
+![](https://raw.githubusercontent.com/gligneul/Lua-Benchmarks/master/results/speedup_lua53.png)
+![](https://raw.githubusercontent.com/gligneul/Lua-Benchmarks/master/results/speedup_lua5.png)
+
+## Usage
+
+```
+usage: lua runbenchmarks.lua [options]
+options:
+ --nruns <n> number of times that each test is executed (default = 3)
+ --no-supress don't supress error messages from tests
+ --output <name> name of the benchmark output
+ --normalize normalize the result based on the first binary
+ --speedup compute the speedup based on the first binary
+ --no-plot don't create the plot with gnuplot
+ --help show this message
+```
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/regex-dna.lua b/lua_benchmark/tests/Lua-Benchmarks/regex-dna.lua
new file mode 100644
index 0000000..2627e05
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/regex-dna.lua
@@ -0,0 +1,59 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Jim Roseborough
+-- modified by Victor Tang
+-- optimized & replaced inefficient use of gsub with gmatch
+-- partitioned sequence to prevent extraneous redundant string copy
+
+seq = io.read("*a")
+ilen, seq = #seq, seq:gsub('>[^%c]*%c*', ''):gsub('%c+', '')
+clen = #seq
+
+local variants = { 'agggtaaa|tttaccct',
+ '[cgt]gggtaaa|tttaccc[acg]',
+ 'a[act]ggtaaa|tttacc[agt]t',
+ 'ag[act]gtaaa|tttac[agt]ct',
+ 'agg[act]taaa|ttta[agt]cct',
+ 'aggg[acg]aaa|ttt[cgt]ccct',
+ 'agggt[cgt]aa|tt[acg]accct',
+ 'agggta[cgt]a|t[acg]taccct',
+ 'agggtaa[cgt]|[acg]ttaccct', }
+
+local subst = { B='(c|g|t)', D='(a|g|t)', H='(a|c|t)', K='(g|t)',
+ M='(a|c)', N='(a|c|g|t)', R='(a|g)', S='(c|g)',
+ V='(a|c|g)', W='(a|t)', Y='(c|t)' }
+
+function countmatches(variant)
+ local n = 0
+ variant:gsub('([^|]+)|?', function(pattern)
+ for _ in seq:gmatch(pattern) do n = n + 1 end
+ end)
+ return n
+end
+
+for _, p in ipairs(variants) do
+ io.write( string.format('%s %d\n', p, countmatches(p)) )
+end
+
+function partitionstring(seq)
+ local seg = math.floor( math.sqrt(#seq) )
+ local seqtable = {}
+ for nextstart = 1, #seq, seg do
+ table.insert(seqtable, seq:sub(nextstart, nextstart + seg - 1))
+ end
+ return seqtable
+end
+function chunk_gsub(t, k, v)
+ for i, p in ipairs(t) do
+ t[i] = p:find(k) and p:gsub(k, v) or t[i]
+ end
+ return t
+end
+
+seq = partitionstring(seq)
+for k, v in pairs(subst) do
+ chunk_gsub(seq, k, v)
+end
+seq = table.concat(seq)
+io.write(string.format('\n%d\n%d\n%d\n', ilen, clen, #seq))
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.png b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.png
new file mode 100644
index 0000000..3a96c4b
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.png
Binary files differ
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.txt
new file mode 100644
index 0000000..4229164
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5.txt
@@ -0,0 +1,14 @@
+test lua-5.1.5 lua-5.2.4 lua-5.3.4
+ack 1.0 1.0106382978723 1.0249494268375
+fixpoint-fact 1.0 0.87217724755006 0.93172507965407
+heapsort 1.0 0.67983128834356 1.0497335701599
+mandelbrot 1.0 0.9497287522604 1.1796945193172
+juliaset 1.0 0.90391321193336 1.0648105887723
+queen 1.0 0.82105263157895 1.0067934782609
+sieve 1.0 0.93239227340267 1.2178554099951
+binary 1.0 1.9514442231076 1.3708238586671
+n-body 1.0 0.90884932234919 1.2101910828025
+fannkuch 1.0 0.80147058823529 1.1354166666667
+fasta 1.0 0.93725490196078 0.91483253588517
+k-nucleotide 1.0 0.95159059474412 1.0747201249675
+spectral-norm 1.0 0.93865698729583 0.97695504344541
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.png b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.png
new file mode 100644
index 0000000..a701896
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.png
Binary files differ
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.txt
new file mode 100644
index 0000000..162511f
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53.txt
@@ -0,0 +1,14 @@
+test lua-5.3.0 lua-5.3.1 lua-5.3.2 lua-5.3.3 lua-5.3.4
+ack 1.0 1.0047169811321 1.0142857142857 1.0205338809035 1.0060728744939
+fixpoint-fact 1.0 0.98553429771349 0.98050139275766 0.94496644295302 0.94538943598926
+heapsort 1.0 0.93150999770168 1.1819772528434 1.2005331753555 1.1812882541533
+mandelbrot 1.0 0.96816037735849 1.1200545702592 1.1439851370181 1.1000446627959
+juliaset 1.0 0.95912698412698 1.0563811188811 1.0431592576608 1.1247091670544
+queen 1.0 0.96021908330931 1.1372482075794 1.1411442274752 1.1318382602786
+sieve 1.0 0.98799039231385 1.1808612440191 1.1963160445952 1.1836930455635
+binary 1.0 1.0183116645303 1.011458712259 1.0568225009502 1.0275314116778
+n-body 1.0 0.96153846153846 1.1900714042843 1.2608069164265 1.2169680111266
+fannkuch 1.0 0.96326981496824 1.2090121317158 1.2183024799162 1.2106907323846
+fasta 1.0 0.96836313617607 1.0004737091426 1.0095602294455 1.0114942528736
+k-nucleotide 1.0 1.0283306017326 1.0588235294118 1.1467362924282 1.1683958499601
+spectral-norm 1.0 0.98923646148671 1.1707802547771 1.1372776488786 1.1320246343341
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53_log.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53_log.txt
new file mode 100644
index 0000000..e2ff8a4
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua53_log.txt
@@ -0,0 +1,69 @@
+Distro: CentOS release 6.8 (Final)
+Kernel: 2.6.32-642.13.1.el6.x86_64
+CPU: Intel(R) Core(TM) i7-4770 CPU @ 3.40GHz
+running "lua-5.3.0 ./ack.lua 3 10"... done
+running "lua-5.3.1 ./ack.lua 3 10"... done
+running "lua-5.3.2 ./ack.lua 3 10"... done
+running "lua-5.3.3 ./ack.lua 3 10"... done
+running "lua ./ack.lua 3 10"... done
+running "lua-5.3.0 ./fixpoint-fact.lua 3000"... done
+running "lua-5.3.1 ./fixpoint-fact.lua 3000"... done
+running "lua-5.3.2 ./fixpoint-fact.lua 3000"... done
+running "lua-5.3.3 ./fixpoint-fact.lua 3000"... done
+running "lua ./fixpoint-fact.lua 3000"... done
+running "lua-5.3.0 ./heapsort.lua 10 250000"... done
+running "lua-5.3.1 ./heapsort.lua 10 250000"... done
+running "lua-5.3.2 ./heapsort.lua 10 250000"... done
+running "lua-5.3.3 ./heapsort.lua 10 250000"... done
+running "lua ./heapsort.lua 10 250000"... done
+running "lua-5.3.0 ./mandel.lua"... done
+running "lua-5.3.1 ./mandel.lua"... done
+running "lua-5.3.2 ./mandel.lua"... done
+running "lua-5.3.3 ./mandel.lua"... done
+running "lua ./mandel.lua"... done
+running "lua-5.3.0 ./qt.lua"... done
+running "lua-5.3.1 ./qt.lua"... done
+running "lua-5.3.2 ./qt.lua"... done
+running "lua-5.3.3 ./qt.lua"... done
+running "lua ./qt.lua"... done
+running "lua-5.3.0 ./queen.lua 12"... done
+running "lua-5.3.1 ./queen.lua 12"... done
+running "lua-5.3.2 ./queen.lua 12"... done
+running "lua-5.3.3 ./queen.lua 12"... done
+running "lua ./queen.lua 12"... done
+running "lua-5.3.0 ./sieve.lua 5000"... done
+running "lua-5.3.1 ./sieve.lua 5000"... done
+running "lua-5.3.2 ./sieve.lua 5000"... done
+running "lua-5.3.3 ./sieve.lua 5000"... done
+running "lua ./sieve.lua 5000"... done
+running "lua-5.3.0 ./binary-trees.lua 15"... done
+running "lua-5.3.1 ./binary-trees.lua 15"... done
+running "lua-5.3.2 ./binary-trees.lua 15"... done
+running "lua-5.3.3 ./binary-trees.lua 15"... done
+running "lua ./binary-trees.lua 15"... done
+running "lua-5.3.0 ./n-body.lua 1000000"... done
+running "lua-5.3.1 ./n-body.lua 1000000"... done
+running "lua-5.3.2 ./n-body.lua 1000000"... done
+running "lua-5.3.3 ./n-body.lua 1000000"... done
+running "lua ./n-body.lua 1000000"... done
+running "lua-5.3.0 ./fannkuch-redux.lua 10"... done
+running "lua-5.3.1 ./fannkuch-redux.lua 10"... done
+running "lua-5.3.2 ./fannkuch-redux.lua 10"... done
+running "lua-5.3.3 ./fannkuch-redux.lua 10"... done
+running "lua ./fannkuch-redux.lua 10"... done
+running "lua-5.3.0 ./fasta.lua 2500000"... done
+running "lua-5.3.1 ./fasta.lua 2500000"... done
+running "lua-5.3.2 ./fasta.lua 2500000"... done
+running "lua-5.3.3 ./fasta.lua 2500000"... done
+running "lua ./fasta.lua 2500000"... done
+running "lua-5.3.0 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.3.1 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.3.2 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.3.3 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.3.0 ./spectral-norm.lua 1000"... done
+running "lua-5.3.1 ./spectral-norm.lua 1000"... done
+running "lua-5.3.2 ./spectral-norm.lua 1000"... done
+running "lua-5.3.3 ./spectral-norm.lua 1000"... done
+running "lua ./spectral-norm.lua 1000"... done
+final done
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5_log.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5_log.txt
new file mode 100644
index 0000000..96d8a9f
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_lua5_log.txt
@@ -0,0 +1,43 @@
+Distro: CentOS release 6.8 (Final)
+Kernel: 2.6.32-642.13.1.el6.x86_64
+CPU: Intel(R) Core(TM) i7-4770 CPU @ 3.40GHz
+running "lua-5.1.5 ./ack.lua 3 10"... done
+running "lua-5.2.4 ./ack.lua 3 10"... done
+running "lua ./ack.lua 3 10"... done
+running "lua-5.1.5 ./fixpoint-fact.lua 3000"... done
+running "lua-5.2.4 ./fixpoint-fact.lua 3000"... done
+running "lua ./fixpoint-fact.lua 3000"... done
+running "lua-5.1.5 ./heapsort.lua 10 250000"... done
+running "lua-5.2.4 ./heapsort.lua 10 250000"... done
+running "lua ./heapsort.lua 10 250000"... done
+running "lua-5.1.5 ./mandel.lua"... done
+running "lua-5.2.4 ./mandel.lua"... done
+running "lua ./mandel.lua"... done
+running "lua-5.1.5 ./qt.lua"... done
+running "lua-5.2.4 ./qt.lua"... done
+running "lua ./qt.lua"... done
+running "lua-5.1.5 ./queen.lua 12"... done
+running "lua-5.2.4 ./queen.lua 12"... done
+running "lua ./queen.lua 12"... done
+running "lua-5.1.5 ./sieve.lua 5000"... done
+running "lua-5.2.4 ./sieve.lua 5000"... done
+running "lua ./sieve.lua 5000"... done
+running "lua-5.1.5 ./binary-trees.lua 15"... done
+running "lua-5.2.4 ./binary-trees.lua 15"... done
+running "lua ./binary-trees.lua 15"... done
+running "lua-5.1.5 ./n-body.lua 1000000"... done
+running "lua-5.2.4 ./n-body.lua 1000000"... done
+running "lua ./n-body.lua 1000000"... done
+running "lua-5.1.5 ./fannkuch-redux.lua 10"... done
+running "lua-5.2.4 ./fannkuch-redux.lua 10"... done
+running "lua ./fannkuch-redux.lua 10"... done
+running "lua-5.1.5 ./fasta.lua 2500000"... done
+running "lua-5.2.4 ./fasta.lua 2500000"... done
+running "lua ./fasta.lua 2500000"... done
+running "lua-5.1.5 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.2.4 ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua-5.1.5 ./spectral-norm.lua 1000"... done
+running "lua-5.2.4 ./spectral-norm.lua 1000"... done
+running "lua ./spectral-norm.lua 1000"... done
+final done
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.png b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.png
new file mode 100644
index 0000000..6f012f5
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.png
Binary files differ
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.txt
new file mode 100644
index 0000000..c2931b9
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit.txt
@@ -0,0 +1,14 @@
+test lua-5.3.4 luajit-2.0.4-interp luajit-2.0.4
+ack 1.0 2.5783972125436 11.472868217054
+fixpoint-fact 1.0 2.5550351288056 2.5580304806565
+heapsort 1.0 2.0149880095923 5.3264659270998
+mandelbrot 1.0 2.0203703703704 18.491525423729
+juliaset 1.0 2.186790505676 3.4851973684211
+queen 1.0 2.1812080536913 11.746987951807
+sieve 1.0 1.7278056951424 10.26368159204
+binary 1.0 3.3795359904819 4.3333333333333
+n-body 1.0 2.279702970297 14.854838709677
+fannkuch 1.0 2.1797410510282 8.9158878504673
+fasta 1.0 1.6870474658085 3.460396039604
+k-nucleotide 1.0 1.7326325411335 3.276577355229
+spectral-norm 1.0 2.2377260981912 17.673469387755
diff --git a/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit_log.txt b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit_log.txt
new file mode 100644
index 0000000..24fa930
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/results/speedup_luajit_log.txt
@@ -0,0 +1,43 @@
+Distro: CentOS release 6.8 (Final)
+Kernel: 2.6.32-642.13.1.el6.x86_64
+CPU: Intel(R) Core(TM) i7-4770 CPU @ 3.40GHz
+running "lua ./ack.lua 3 10"... done
+running "luajit -joff ./ack.lua 3 10"... done
+running "luajit ./ack.lua 3 10"... done
+running "lua ./fixpoint-fact.lua 3000"... done
+running "luajit -joff ./fixpoint-fact.lua 3000"... done
+running "luajit ./fixpoint-fact.lua 3000"... done
+running "lua ./heapsort.lua 10 250000"... done
+running "luajit -joff ./heapsort.lua 10 250000"... done
+running "luajit ./heapsort.lua 10 250000"... done
+running "lua ./mandel.lua"... done
+running "luajit -joff ./mandel.lua"... done
+running "luajit ./mandel.lua"... done
+running "lua ./qt.lua"... done
+running "luajit -joff ./qt.lua"... done
+running "luajit ./qt.lua"... done
+running "lua ./queen.lua 12"... done
+running "luajit -joff ./queen.lua 12"... done
+running "luajit ./queen.lua 12"... done
+running "lua ./sieve.lua 5000"... done
+running "luajit -joff ./sieve.lua 5000"... done
+running "luajit ./sieve.lua 5000"... done
+running "lua ./binary-trees.lua 15"... done
+running "luajit -joff ./binary-trees.lua 15"... done
+running "luajit ./binary-trees.lua 15"... done
+running "lua ./n-body.lua 1000000"... done
+running "luajit -joff ./n-body.lua 1000000"... done
+running "luajit ./n-body.lua 1000000"... done
+running "lua ./fannkuch-redux.lua 10"... done
+running "luajit -joff ./fannkuch-redux.lua 10"... done
+running "luajit ./fannkuch-redux.lua 10"... done
+running "lua ./fasta.lua 2500000"... done
+running "luajit -joff ./fasta.lua 2500000"... done
+running "luajit ./fasta.lua 2500000"... done
+running "lua ./k-nucleotide.lua < fasta1000000.txt"... done
+running "luajit -joff ./k-nucleotide.lua < fasta1000000.txt"... done
+running "luajit ./k-nucleotide.lua < fasta1000000.txt"... done
+running "lua ./spectral-norm.lua 1000"... done
+running "luajit -joff ./spectral-norm.lua 1000"... done
+running "luajit ./spectral-norm.lua 1000"... done
+final done
diff --git a/lua_benchmark/tests/Lua-Benchmarks/runbenchmarks.lua b/lua_benchmark/tests/Lua-Benchmarks/runbenchmarks.lua
new file mode 100755
index 0000000..dafbb3e
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/runbenchmarks.lua
@@ -0,0 +1,234 @@
+#!/bin/env lua
+
+-- Configuration ---------------------------------------------------------------
+
+-- List of binaries that will be tested
+local binaries = {
+ { 'lua-5.3.4', 'lua' },
+ { 'luajit-2.0.4-interp', 'luajit -joff' },
+ { 'luajit-2.0.4', 'luajit' },
+}
+
+-- List of tests
+local tests_root = './'
+local tests = {
+ { 'ack', 'ack.lua 3 10' },
+ { 'fixpoint-fact', 'fixpoint-fact.lua 3000' },
+ { 'heapsort', 'heapsort.lua 10 250000' },
+ { 'mandelbrot', 'mandel.lua' },
+ { 'juliaset', 'qt.lua' },
+ { 'queen', 'queen.lua 12' },
+ { 'sieve', 'sieve.lua 5000' }, -- Sieve of Eratosthenes
+ { 'binary', 'binary-trees.lua 15' },
+ { 'n-body', 'n-body.lua 1000000' },
+ { 'fannkuch', 'fannkuch-redux.lua 10' },
+ { 'fasta', 'fasta.lua 2500000' },
+ { 'k-nucleotide', 'k-nucleotide.lua < fasta1000000.txt' },
+ --{ 'regex-dna', 'regex-dna.lua < fasta1000000.txt' },
+ { 'spectral-norm', 'spectral-norm.lua 1000' },
+}
+
+-- Command line arguments ------------------------------------------------------
+
+local nruns = 3
+local supress_errors = true
+local basename = 'results'
+local normalize = false
+local speedup = false
+local plot = true
+
+local usage = [[
+usage: lua ]] .. arg[0] .. [[ [options]
+options:
+ --nruns <n> number of times that each test is executed (default = 3)
+ --no-supress don't supress error messages from tests
+ --output <name> name of the benchmark output
+ --normalize normalize the result based on the first binary
+ --speedup compute the speedup based on the first binary
+ --no-plot don't create the plot with gnuplot
+ --help show this message
+]]
+
+local function parse_args()
+ local function parse_error(msg)
+ print('Error: ' .. msg .. '\n' .. usage)
+ os.exit(1)
+ end
+ local function get_next_arg(i)
+ if i + 1 > #arg then
+ parse_error(arg[i] .. ' requires a value')
+ end
+ local v = arg[i + 1]
+ arg[i + 1] = nil
+ return v
+ end
+ for i = 1, #arg do
+ if not arg[i] then goto continue end
+ if arg[i] == '--nruns' then
+ nruns = tonumber(get_next_arg(i))
+ if not nruns or nruns < 1 then
+ parse_error('nruns should be a number greater than 1')
+ end
+ elseif arg[i] == '--no-supress' then
+ supress_errors = false
+ elseif arg[i] == '--output' then
+ basename = get_next_arg(i)
+ elseif arg[i] == '--normalize' then
+ normalize = true
+ elseif arg[i] == '--speedup' then
+ speedup = true
+ elseif arg[i] == '--no-plot' then
+ plot = false
+ elseif arg[i] == '--help' then
+ print(usage)
+ os.exit()
+ else
+ parse_error('invalid argument: ' .. arg[i])
+ end
+ ::continue::
+ end
+end
+
+-- Implementation --------------------------------------------------------------
+
+-- Run the command a single time and returns the time elapsed
+local function measure(cmd)
+ local time_cmd = '{ TIMEFORMAT=\'%3R\'; time ' .. cmd ..
+ ' > /dev/null; } 2>&1'
+ local handle = io.popen(time_cmd)
+ local result = handle:read("*a")
+ local time_elapsed = tonumber(result)
+ handle:close()
+ if not time_elapsed then
+ error('Invalid output for "' .. cmd .. '":\n' .. result)
+ end
+ return time_elapsed
+end
+
+-- Run the command $nruns and return the fastest time
+local function benchmark(cmd)
+ local min = 999
+ io.write('running "' .. cmd .. '"... ')
+ for _ = 1, nruns do
+ local time = measure(cmd)
+ min = math.min(min, time)
+ end
+ io.write('done\n')
+ return min
+end
+
+-- Create a matrix with n rows
+local function create_matrix(n)
+ local m = {}
+ for i = 1, n do
+ m[i] = {}
+ end
+ return m
+end
+
+-- Measure the time for each binary and test
+-- Return a matrix with the result (test x binary)
+local function run_all()
+ local results = create_matrix(#tests)
+ for i, test in ipairs(tests) do
+ local test_path = tests_root .. test[2]
+ for j, binary in ipairs(binaries) do
+ local cmd = binary[2] .. ' ' .. test_path
+ local ok, msg = pcall(function()
+ results[i][j] = benchmark(cmd)
+ end)
+ if not ok and not supress_errors then
+ io.write('error:\n' .. msg .. '\n---\n')
+ end
+ end
+ end
+ return results
+end
+
+-- Perform an operation for each value in the matrix
+local function process_results(results, f)
+ for _, line in ipairs(results) do
+ local base = line[1]
+ for i = 1, #binaries do
+ line[i] = f(line[i], base)
+ end
+ end
+end
+
+-- Print info about the host computer
+local function computer_info()
+ os.execute([[
+echo "Distro: "`cat /etc/*-release | head -1`
+echo "Kernel: "`uname -r`
+echo "CPU: "`cat /proc/cpuinfo | grep 'model name' | tail -1 | \
+ sed 's/model name.*:.//'`]])
+end
+
+-- Creates and saves the gnuplot data file
+local function create_data_file(results)
+ local data = 'test\t'
+ for _, binary in ipairs(binaries) do
+ data = data .. binary[1] .. '\t'
+ end
+ data = data .. '\n'
+ for i, test in ipairs(tests) do
+ data = data .. test[1] .. '\t'
+ for j, _ in ipairs(binaries) do
+ data = data .. results[i][j] .. '\t'
+ end
+ data = data .. '\n'
+ end
+ io.open(basename .. '.txt', 'w'):write(data):close()
+end
+
+-- Generates the output image with gnuplot
+local function generate_image()
+ local ylabel
+ if normalize then
+ ylabel = 'Normalized time'
+ elseif speedup then
+ ylabel = 'Speedup'
+ else
+ ylabel = 'Elapsed time'
+ end
+ os.execute('gnuplot -e "datafile=\'' .. basename .. '.txt\'" ' ..
+ '-e "outfile=\'' .. basename .. '.png\'" ' ..
+ '-e "ylabel=\'' .. ylabel .. '\'" ' ..
+ '-e "nbinaries=' .. #binaries .. '" plot.gpi')
+end
+
+local function setup()
+ os.execute('luajit ' .. tests_root .. 'fasta.lua 1000000 > fasta1000000.txt')
+end
+
+local function teardown()
+ os.execute('rm fasta1000000.txt')
+end
+
+local function main()
+ parse_args()
+ computer_info()
+ setup()
+ local results = run_all()
+ teardown()
+ local function f(v, base)
+ if not v then
+ return 0
+ elseif not base then
+ return v
+ elseif speedup then
+ return base / v
+ elseif normalize then
+ return v / base
+ else
+ return v
+ end
+ end
+ process_results(results, f)
+ create_data_file(results)
+ if plot then generate_image() end
+ print('final done')
+end
+
+main()
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/scimark.lua b/lua_benchmark/tests/Lua-Benchmarks/scimark.lua
new file mode 100644
index 0000000..b833b30
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/scimark.lua
@@ -0,0 +1,433 @@
+------------------------------------------------------------------------------
+-- Lua SciMark (2010-12-20).
+--
+-- A literal translation of SciMark 2.0a, written in Java and C.
+-- Credits go to the original authors Roldan Pozo and Bruce Miller.
+-- See: http://math.nist.gov/scimark2/
+------------------------------------------------------------------------------
+-- Copyright (C) 2006-2010 Mike Pall. All rights reserved.
+--
+-- Permission is hereby granted, free of charge, to any person obtaining
+-- a copy of this software and associated documentation files (the
+-- "Software"), to deal in the Software without restriction, including
+-- without limitation the rights to use, copy, modify, merge, publish,
+-- distribute, sublicense, and/or sell copies of the Software, and to
+-- permit persons to whom the Software is furnished to do so, subject to
+-- the following conditions:
+--
+-- The above copyright notice and this permission notice shall be
+-- included in all copies or substantial portions of the Software.
+--
+-- THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+-- EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+-- MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+-- IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+-- CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+-- TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+-- SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+--
+-- [ MIT license: http://www.opensource.org/licenses/mit-license.php ]
+------------------------------------------------------------------------------
+
+------------------------------------------------------------------------------
+-- Modificatin to be compatible with Lua 5.3
+------------------------------------------------------------------------------
+
+if table and table.unpack then
+ unpack = table.unpack
+end
+
+------------------------------------------------------------------------------
+
+local SCIMARK_VERSION = "2010-12-10"
+local SCIMARK_COPYRIGHT = "Copyright (C) 2006-2010 Mike Pall"
+
+local MIN_TIME = 2.0
+local RANDOM_SEED = 101009 -- Must be odd.
+local SIZE_SELECT = "small"
+
+local benchmarks = {
+ "FFT", "SOR", "MC", "SPARSE", "LU",
+ small = {
+ FFT = { 1024 },
+ SOR = { 100 },
+ MC = { },
+ SPARSE = { 1000, 5000 },
+ LU = { 100 },
+ },
+ large = {
+ FFT = { 1048576 },
+ SOR = { 1000 },
+ MC = { },
+ SPARSE = { 100000, 1000000 },
+ LU = { 1000 },
+ },
+}
+
+local abs, log, sin, floor = math.abs, math.log, math.sin, math.floor
+local pi, clock = math.pi, os.clock
+local format = string.format
+
+------------------------------------------------------------------------------
+-- Select array type: Lua tables or native (FFI) arrays
+------------------------------------------------------------------------------
+
+local darray, iarray
+
+local function array_init()
+ if jit and jit.status and jit.status() then
+ local ok, ffi = pcall(require, "ffi")
+ if ok then
+ darray = ffi.typeof("double[?]")
+ iarray = ffi.typeof("int[?]")
+ return
+ end
+ end
+ function darray(n) return {} end
+ iarray = darray
+end
+
+------------------------------------------------------------------------------
+-- This is a Lagged Fibonacci Pseudo-random Number Generator with
+-- j, k, M = 5, 17, 31. Pretty weak, but same as C/Java SciMark.
+------------------------------------------------------------------------------
+
+local rand, rand_init
+
+if jit and jit.status and jit.status() then
+ -- LJ2 has bit operations and zero-based arrays (internally).
+ local bit = require("bit")
+ local band, sar = bit.band, bit.arshift
+ function rand_init(seed)
+ local Rm, Rj, Ri = iarray(17), 16, 11
+ for i=0,16 do Rm[i] = 0 end
+ for i=16,0,-1 do
+ seed = band(seed*9069, 0x7fffffff)
+ Rm[i] = seed
+ end
+ function rand()
+ local i = band(Ri+1, sar(Ri-16, 31))
+ local j = band(Rj+1, sar(Rj-16, 31))
+ Ri, Rj = i, j
+ local k = band(Rm[i] - Rm[j], 0x7fffffff)
+ Rm[j] = k
+ return k * (1.0/2147483647.0)
+ end
+ end
+else
+ -- Better for standard Lua with one-based arrays and without bit operations.
+ function rand_init(seed)
+ local Rm, Rj = {}, 1
+ for i=1,17 do Rm[i] = 0 end
+ for i=17,1,-1 do
+ seed = (seed*9069) % (2^31)
+ Rm[i] = seed
+ end
+ function rand()
+ local j, m = Rj, Rm
+ local h = j - 5
+ if h < 1 then h = h + 17 end
+ local k = m[h] - m[j]
+ if k < 0 then k = k + 2147483647 end
+ m[j] = k
+ if j < 17 then Rj = j + 1 else Rj = 1 end
+ return k * (1.0/2147483647.0)
+ end
+ end
+end
+
+local function random_vector(n)
+ local v = darray(n+1)
+ for x=1,n do v[x] = rand() end
+ return v
+end
+
+local function random_matrix(m, n)
+ local a = {}
+ for y=1,m do
+ local v = darray(n+1)
+ a[y] = v
+ for x=1,n do v[x] = rand() end
+ end
+ return a
+end
+
+------------------------------------------------------------------------------
+-- FFT: Fast Fourier Transform.
+------------------------------------------------------------------------------
+
+local function fft_bitreverse(v, n)
+ local j = 0
+ for i=0,2*n-4,2 do
+ if i < j then
+ v[i+1], v[i+2], v[j+1], v[j+2] = v[j+1], v[j+2], v[i+1], v[i+2]
+ end
+ local k = n
+ while k <= j do j = j - k; k = k / 2 end
+ j = j + k
+ end
+end
+
+local function fft_transform(v, n, dir)
+ if n <= 1 then return end
+ fft_bitreverse(v, n)
+ local dual = 1
+ repeat
+ local dual2 = 2*dual
+ for i=1,2*n-1,2*dual2 do
+ local j = i+dual2
+ local ir, ii = v[i], v[i+1]
+ local jr, ji = v[j], v[j+1]
+ v[j], v[j+1] = ir - jr, ii - ji
+ v[i], v[i+1] = ir + jr, ii + ji
+ end
+ local theta = dir * pi / dual
+ local s, s2 = sin(theta), 2.0 * sin(theta * 0.5)^2
+ local wr, wi = 1.0, 0.0
+ for a=3,dual2-1,2 do
+ wr, wi = wr - s*wi - s2*wr, wi + s*wr - s2*wi
+ for i=a,a+2*(n-dual2),2*dual2 do
+ local j = i+dual2
+ local jr, ji = v[j], v[j+1]
+ local dr, di = wr*jr - wi*ji, wr*ji + wi*jr
+ local ir, ii = v[i], v[i+1]
+ v[j], v[j+1] = ir - dr, ii - di
+ v[i], v[i+1] = ir + dr, ii + di
+ end
+ end
+ dual = dual2
+ until dual >= n
+end
+
+function benchmarks.FFT(n)
+ local l2n = log(n)/log(2)
+ if l2n % 1 ~= 0 then
+ io.stderr:write("Error: FFT data length is not a power of 2\n")
+ os.exit(1)
+ end
+ local v = random_vector(n*2)
+ return function(cycles)
+ local norm = 1.0 / n
+ for p=1,cycles do
+ fft_transform(v, n, -1)
+ fft_transform(v, n, 1)
+ for i=1,n*2 do v[i] = v[i] * norm end
+ end
+ return ((5*n-2)*l2n + 2*(n+1)) * cycles
+ end
+end
+
+------------------------------------------------------------------------------
+-- SOR: Jacobi Successive Over-Relaxation.
+------------------------------------------------------------------------------
+
+local function sor_run(mat, m, n, cycles, omega)
+ local om4, om1 = omega*0.25, 1.0-omega
+ m = m - 1
+ n = n - 1
+ for i=1,cycles do
+ for y=2,m do
+ local v, vp, vn = mat[y], mat[y-1], mat[y+1]
+ for x=2,n do
+ v[x] = om4*((vp[x]+vn[x])+(v[x-1]+v[x+1])) + om1*v[x]
+ end
+ end
+ end
+end
+
+function benchmarks.SOR(n)
+ local mat = random_matrix(n, n)
+ return function(cycles)
+ sor_run(mat, n, n, cycles, 1.25)
+ return (n-1)*(n-1)*cycles*6
+ end
+end
+
+------------------------------------------------------------------------------
+-- MC: Monte Carlo Integration.
+------------------------------------------------------------------------------
+
+local function mc_integrate(cycles)
+ local under_curve = 0
+ local rand = rand
+ for i=1,cycles do
+ local x = rand()
+ local y = rand()
+ if x*x + y*y <= 1.0 then under_curve = under_curve + 1 end
+ end
+ return (under_curve/cycles) * 4
+end
+
+function benchmarks.MC()
+ return function(cycles)
+ local res = mc_integrate(cycles)
+ assert(math.sqrt(cycles)*math.abs(res-math.pi) < 5.0, "bad MC result")
+ return cycles * 4 -- Way off, but same as SciMark in C/Java.
+ end
+end
+
+------------------------------------------------------------------------------
+-- Sparse Matrix Multiplication.
+------------------------------------------------------------------------------
+
+local function sparse_mult(n, cycles, vy, val, row, col, vx)
+ for p=1,cycles do
+ for r=1,n do
+ local sum = 0
+ for i=row[r],row[r+1]-1 do sum = sum + vx[col[i]] * val[i] end
+ vy[r] = sum
+ end
+ end
+end
+
+function benchmarks.SPARSE(n, nz)
+ local nr = floor(nz/n)
+ local anz = nr*n
+ local vx = random_vector(n)
+ local val = random_vector(anz)
+ local vy, col, row = darray(n+1), iarray(nz+1), iarray(n+2)
+ row[1] = 1
+ for r=1,n do
+ local step = floor(r/nr)
+ if step < 1 then step = 1 end
+ local rr = row[r]
+ row[r+1] = rr+nr
+ for i=0,nr-1 do col[rr+i] = 1+i*step end
+ end
+ return function(cycles)
+ sparse_mult(n, cycles, vy, val, row, col, vx)
+ return anz*cycles*2
+ end
+end
+
+------------------------------------------------------------------------------
+-- LU: Dense Matrix Factorization.
+------------------------------------------------------------------------------
+
+local function lu_factor(a, pivot, m, n)
+ local min_m_n = m < n and m or n
+ for j=1,min_m_n do
+ local jp, t = j, abs(a[j][j])
+ for i=j+1,m do
+ local ab = abs(a[i][j])
+ if ab > t then
+ jp = i
+ t = ab
+ end
+ end
+ pivot[j] = jp
+ if a[jp][j] == 0 then error("zero pivot") end
+ if jp ~= j then a[j], a[jp] = a[jp], a[j] end
+ if j < m then
+ local recp = 1.0 / a[j][j]
+ for k=j+1,m do
+ local v = a[k]
+ v[j] = v[j] * recp
+ end
+ end
+ if j < min_m_n then
+ for i=j+1,m do
+ local vi, vj = a[i], a[j]
+ local eij = vi[j]
+ for k=j+1,n do vi[k] = vi[k] - eij * vj[k] end
+ end
+ end
+ end
+end
+
+local function matrix_alloc(m, n)
+ local a = {}
+ for y=1,m do a[y] = darray(n+1) end
+ return a
+end
+
+local function matrix_copy(dst, src, m, n)
+ for y=1,m do
+ local vd, vs = dst[y], src[y]
+ for x=1,n do vd[x] = vs[x] end
+ end
+end
+
+function benchmarks.LU(n)
+ local mat = random_matrix(n, n)
+ local tmp = matrix_alloc(n, n)
+ local pivot = iarray(n+1)
+ return function(cycles)
+ for i=1,cycles do
+ matrix_copy(tmp, mat, n, n)
+ lu_factor(tmp, pivot, n, n)
+ end
+ return 2.0/3.0*n*n*n*cycles
+ end
+end
+
+------------------------------------------------------------------------------
+-- Main program.
+------------------------------------------------------------------------------
+
+local function printf(...)
+ io.write(format(...))
+end
+
+local function fmtparams(p1, p2)
+ if p2 then return format("[%d, %d]", p1, p2)
+ elseif p1 then return format("[%d]", p1) end
+ return ""
+end
+
+local function measure(min_time, name, ...)
+ array_init()
+ rand_init(RANDOM_SEED)
+ local run = benchmarks[name](...)
+ local cycles = 1
+ repeat
+ local tm = clock()
+ local flops = run(cycles, ...)
+ tm = clock() - tm
+ if tm >= min_time then
+ local res = flops / tm * 1.0e-6
+ local p1, p2 = ...
+ printf("%-7s %8.2f %s\n", name, res, fmtparams(...))
+ return res
+ end
+ cycles = cycles * 2
+ until false
+end
+
+printf("Lua SciMark %s based on SciMark 2.0a. %s.\n\n",
+ SCIMARK_VERSION, SCIMARK_COPYRIGHT)
+
+while arg and arg[1] do
+ local a = table.remove(arg, 1)
+ if a == "-noffi" then
+ package.preload.ffi = nil
+ elseif a == "-small" then
+ SIZE_SELECT = "small"
+ elseif a == "-large" then
+ SIZE_SELECT = "large"
+ elseif benchmarks[a] then
+ local p = benchmarks[SIZE_SELECT][a]
+ measure(MIN_TIME, a, tonumber(arg[1]) or p[1], tonumber(arg[2]) or p[2])
+ return
+ else
+ printf("Usage: scimark [-noffi] [-small|-large] [BENCH params...]\n\n")
+ printf("BENCH -small -large\n")
+ printf("---------------------------------------\n")
+ for _,name in ipairs(benchmarks) do
+ printf("%-7s %-13s %s\n", name,
+ fmtparams(unpack(benchmarks.small[name])),
+ fmtparams(unpack(benchmarks.large[name])))
+ end
+ printf("\n")
+ os.exit(1)
+ end
+end
+
+local params = benchmarks[SIZE_SELECT]
+local sum = 0
+for _,name in ipairs(benchmarks) do
+ sum = sum + measure(MIN_TIME, name, unpack(params[name]))
+end
+printf("\nSciMark %8.2f [%s problem sizes]\n", sum / #benchmarks, SIZE_SELECT)
+io.flush()
+
diff --git a/lua_benchmark/tests/Lua-Benchmarks/sieve.lua b/lua_benchmark/tests/Lua-Benchmarks/sieve.lua
new file mode 100644
index 0000000..e2c1487
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/sieve.lua
@@ -0,0 +1,33 @@
+-- $Id: sieve.lua,v 1.9 2001/05/06 04:37:45 doug Exp $
+-- http://www.bagley.org/~doug/shootout/
+--
+-- Roberto Ierusalimschy pointed out the for loop is much
+-- faster for our purposes here than using a while loop.
+
+local count = 0
+
+function main(num, lim)
+ local flags = {}
+ for num=num,1,-1 do
+ count = 0
+ for i=1,lim do
+ flags[i] = 1
+ end
+ for i=2,lim do
+ if flags[i] == 1 then
+ k = 0
+ for k=i+i, lim, i do
+ flags[k] = 0
+ end
+ count = count + 1
+ end
+ end
+ end
+end
+
+NUM = tonumber((arg and arg[1])) or 100
+lim = (arg and arg[2]) or 8192
+print(NUM,lim)
+count = 0
+main(NUM, lim)
+print("Count: ", count)
diff --git a/lua_benchmark/tests/Lua-Benchmarks/spectral-norm.lua b/lua_benchmark/tests/Lua-Benchmarks/spectral-norm.lua
new file mode 100644
index 0000000..5ba652f
--- /dev/null
+++ b/lua_benchmark/tests/Lua-Benchmarks/spectral-norm.lua
@@ -0,0 +1,43 @@
+-- The Computer Language Benchmarks Game
+-- http://benchmarksgame.alioth.debian.org/
+-- contributed by Mike Pall
+
+local function A(i, j)
+ local ij = i+j-1
+ return 1.0 / (ij * (ij-1) * 0.5 + i)
+end
+
+local function Av(x, y, N)
+ for i=1,N do
+ local a = 0
+ for j=1,N do a = a + x[j] * A(i, j) end
+ y[i] = a
+ end
+end
+
+local function Atv(x, y, N)
+ for i=1,N do
+ local a = 0
+ for j=1,N do a = a + x[j] * A(j, i) end
+ y[i] = a
+ end
+end
+
+local function AtAv(x, y, t, N)
+ Av(x, t, N)
+ Atv(t, y, N)
+end
+
+local N = tonumber(arg and arg[1]) or 100
+local u, v, t = {}, {}, {}
+for i=1,N do u[i] = 1 end
+
+for i=1,10 do AtAv(u, v, t, N) AtAv(v, u, t, N) end
+
+local vBv, vv = 0, 0
+for i=1,N do
+ local ui, vi = u[i], v[i]
+ vBv = vBv + ui*vi
+ vv = vv + vi*vi
+end
+io.write(string.format("%0.9f\n", math.sqrt(vBv / vv)))
generated by cgit on debian on lair
contact matthew@masot.net with questions or feedback